<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1475-2875-8-140</ui>
   <ji>1475-2875</ji>
   <fm>
      <dochead>Research</dochead>
      <bibl>
         <title>
            <p>Characterization of the repertoire diversity of the <it>Plasmodium falciparum stevor </it>multigene family in laboratory and field isolates</p>
         </title>
         <aug>
            <au ce="yes" id="A1">
               <snm>Blythe</snm>
               <mi>E</mi>
               <fnm>Jane</fnm>
               <insr iid="I1"/>
               <insr iid="I2"/>
               <email>JEB@kcs.org.uk</email>
            </au>
            <au ce="yes" id="A2">
               <snm>Niang</snm>
               <fnm>Makhtar</fnm>
               <insr iid="I1"/>
               <email>MNiang@ntu.edu.sg</email>
            </au>
            <au id="A3">
               <snm>Marsh</snm>
               <fnm>Kevin</fnm>
               <insr iid="I3"/>
               <email>kmarsh@kilifi.kemri-wellcome.org</email>
            </au>
            <au id="A4">
               <snm>Holder</snm>
               <mi>A</mi>
               <fnm>Anthony</fnm>
               <insr iid="I2"/>
               <email>aholder@nimr.mrc.ac.uk</email>
            </au>
            <au id="A5">
               <snm>Langhorne</snm>
               <fnm>Jean</fnm>
               <insr iid="I2"/>
               <email>jlangho@nimr.mrc.ac.uk</email>
            </au>
            <au ca="yes" id="A6">
               <snm>Preiser</snm>
               <mi>R</mi>
               <fnm>Peter</fnm>
               <insr iid="I1"/>
               <email>prpreiser@ntu.edu.sg</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Nanyang Technological University, School of Biological Sciences, 60 Nanyang Drive, Singapore 637551, Singapore</p>
            </ins>
            <ins id="I2">
               <p>Division of Parasitology, National Institute for Medical Research, The Ridgeway, London NW7 1AA, UK</p>
            </ins>
            <ins id="I3">
               <p>Kenya Medical Research Institute (KEMRI), PO Box 230, Kilifi, Kenya</p>
            </ins>
         </insg>
         <source>Malaria Journal</source>
         <issn>1475-2875</issn>
         <pubdate>2009</pubdate>
         <volume>8</volume>
         <issue>1</issue>
         <fpage>140</fpage>
         <url>http://www.malariajournal.com/content/8/1/140</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">19558642</pubid>
               <pubid idtype="doi">10.1186/1475-2875-8-140</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>24</day>
               <month>4</month>
               <year>2009</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>26</day>
               <month>6</month>
               <year>2009</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>26</day>
               <month>6</month>
               <year>2009</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2009</year>
         <collab>Blythe et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>The evasion of host immune response by the human malaria parasite <it>Plasmodium falciparum </it>has been linked to expression of a range of variable antigens on the infected erythrocyte surface. Several genes are potentially involved in this process with the <it>var</it>, <it>rif </it>and <it>stevor </it>multigene families being the most likely candidates and coding for rapidly evolving proteins. The high sequence diversity of proteins encoded by these gene families may have evolved as an immune evasion strategy that enables the parasite to establish long lasting chronic infections. Previous findings have shown that the hypervariable region (HVR) of STEVOR has significant sequence diversity both within as well as across different <it>P. falciparum </it>lines. However, these studies did not address whether or not there are ancestral <it>stevor </it>that can be found in different parasites.</p>
            </sec>
            <sec>
               <st>
                  <p>Methods</p>
               </st>
               <p>DNA and RNA sequences analysis as well as phylogenetic approaches were used to analyse the <it>stevor </it>sequence repertoire and diversity in laboratory lines and Kilifi (Kenya) fresh isolates.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>Conserved <it>stevor </it>genes were identified in different <it>P. falciparum </it>isolates from different global locations. Consistent with previous studies, the HVR of the <it>stevor </it>gene family was found to be highly divergent both within and between isolates. Importantly phylogenetic analysis shows some clustering of <it>stevor </it>sequences both within a single parasite clone as well as across different parasite isolates.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>This indicates that the ancestral <it>P. falciparum </it>parasite genome already contained multiple <it>stevor </it>genes that have subsequently diversified further within the different <it>P. falciparum </it>populations. It also confirms that STEVOR is under strong selection pressure.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <meta>
      <classifications>
         <classification id="endnote" subtype="user_supplied_xml" type="bmc"/>
      </classifications>
   </meta>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p><it>Plasmodium </it>malaria is an infectious disease of global significance with more than 500 million people suffering from the disease and at least one million dying each year <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. The <it>P. falciparum </it>genome project <abbrgrp><abbr bid="B2">2</abbr></abbrgrp> has revealed the presence of several multicopy gene families which code for hypervariable antigens that are exported to the surface of the infected host erythrocyte and represent targets of naturally acquired immunity to malaria. To date <it>var</it>, <it>rif </it>as well as <it>stevor </it>have been described <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr></abbrgrp> as the major variant surface antigens (VSAs). These multigene families are predominantly situated at the sub-telomeric ends of chromosomes <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr></abbrgrp>, where gene rearrangements are frequent <abbrgrp><abbr bid="B7">7</abbr><abbr bid="B8">8</abbr></abbrgrp> leading to high rates of recombination, thus facilitating their rapid evolution and diversity.</p>
         <p>While some <it>rif </it>and <it>var </it>genes are found in centrally located clusters, most <it>stevor </it>genes are found at chromosome ends <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>. The high sequence diversity of proteins encoded by these gene families may have evolved as an immune evasion strategy that enables the parasite to establish long lasting chronic infections <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>.</p>
         <p>The <it>P. falciparum </it>genome contains between 50 and 60 <it>var </it>genes <abbrgrp><abbr bid="B2">2</abbr></abbrgrp> that code for the Erythrocyte Membrane Protein 1 (PfEMP1) <abbrgrp><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr></abbrgrp>. EMP1 is linked not only to immune evasion but also to parasite sequestration and pathology and is by far the best studied multigene family in <it>P. falciparum </it><abbrgrp><abbr bid="B11">11</abbr><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr></abbrgrp>.</p>
         <p><it>Stevor </it>and <it>rif </it>share structural similarities and this relationship is emphasized by the existence of a RIFIN-STEVOR family (PF02009) in the PFAM database <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>. Characteristically, they are defined as small polypeptides with a putative signal sequence followed by a semi-conserved domain, an HVR and a conserved C-terminal domain <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>. In both protein families, two predicted transmembrane-spanning regions flank the HVR which has been predicted to form a loop on the infected red blood cell (iRBC) surface, exposing it to the host immune system and probably resulting in distinct evolution into novel functional units <abbrgrp><abbr bid="B3">3</abbr><abbr bid="B16">16</abbr></abbrgrp>. However, STEVOR and RIFIN differ in that the HVR of RIFIN is up to 300 bp longer than the equivalent region in STEVOR. Moreover, STEVOR are a distinct, more conserved, and lower copy number family <abbrgrp><abbr bid="B17">17</abbr></abbrgrp> than RIFIN. The <it>rif </it>and <it>stevor </it>(150&#8211;200 copies and 30&#8211;33 copies respectively in the 3D7 genome) repertoire diversity has been studied in the 3D7 parasite clone, and in several other laboratory parasite lines from different geographic origins <abbrgrp><abbr bid="B18">18</abbr><abbr bid="B19">19</abbr></abbrgrp>. Based on these studies, it is clear that the HVR of STEVOR has significant sequence diversity both within as well as across different <it>P. falciparum </it>lines. These studies did not address whether or not there are ancestral <it>stevor </it>that can be found in different parasites.</p>
         <p>The entire genome of the <it>P. falciparum </it>3D7 parasite clone was sequenced completely first as part of the malaria genome project <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>. A number of additional lines have now also been at least partially sequenced so that there is now considerable information on the VSA repertoire on these parasite species. The ancestors of parasites isolated worldwide are most likely to be from Africa <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>. A study of <it>var </it>gene sequences in 12 Kilifi parasite isolates has shown a comparable number of broadly classified types as the 3D7 genome <abbrgrp><abbr bid="B21">21</abbr></abbrgrp>. Similarly, another study of <it>var </it>sequences from Amazonian parasite isolates indicated that the expected gene repertoire was again similar to that of the 3D7 genome and that the Amazonian <it>var </it>genes were most similar to <it>var </it>identified in other American isolates <abbrgrp><abbr bid="B18">18</abbr></abbrgrp>.</p>
         <p>The 3D7 <it>var </it>genes have been grouped into three majors types based on sequence analysis of the intron and 5' and 3' un-translated regions (UTR) <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B22">22</abbr><abbr bid="B23">23</abbr></abbrgrp>, and the Kilifi <it>var </it>had a similar type distribution <abbrgrp><abbr bid="B21">21</abbr></abbrgrp>. Recently, phylogenetic approaches have enabled subdivision of the RIFIN protein family into two major A- and B-subgroups <abbrgrp><abbr bid="B24">24</abbr></abbrgrp> associated with distinct subcellular location and developmental expression patterns <abbrgrp><abbr bid="B25">25</abbr></abbrgrp>.</p>
         <p>Such important data are currently missing for the <it>stevor </it>multigene family and it is not known whether field isolates contain a similar number of <it>stevor </it>to that of the 3D7 clone. In addition, a more extensive study of <it>stevor </it>from isolates worldwide is required in order to estimate both the repertoire size and the extent of diversity. Comparative analysis of long-term laboratory-adapted parasites and fresh clinical isolates has shown that laboratory-adapted lines are not significantly more or less divergent than recent isolates <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>. However, the 3D7 clone was shown to have accumulated DNA in culture through insertions of +1nucleotide/kb <abbrgrp><abbr bid="B27">27</abbr></abbrgrp>, and this might suggest divergent sequences compared to fresh isolates.</p>
         <p>In this study, DNA and RNA sequence analysis were combined as well as phylogenetic approaches to analyse the <it>stevor </it>sequence repertoire and diversity in laboratory lines and fresh isolates from Kilifi in Kenya. Conserved <it>stevor </it>genes (orthologues) were identified in different <it>P. falciparum </it>isolates from different global locations. Consistent with previous studies, the HVR of the <it>stevor </it>gene family was found to be highly divergent both within and between isolates. Importantly, phylogenetic analysis shows some clustering of <it>stevor </it>sequences both within a single parasite clone as well as across different parasite isolates. These data indicate that the ancestral <it>P. falciparum </it>parasite genome already contained multiple <it>stevor </it>genes that subsequently diversified further within the different <it>P. falciparum </it>populations.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Parasites</p>
            </st>
            <p>Parasites used in this study were either well-characterized laboratory lines or were isolated from blood samples obtained at the KEMRI-Wellcome Trust, Kilifi, Kenya. Parasite lines and their origin are listed (Table <tblr tid="T1">1</tblr>). The African parasites were collected at Kilifi district hospital, situated 60 km north of Mombasa on the Kenyan coast. More than 10% of the children under five years of age, who reside within the Kilifi district, are admitted into hospital each year. In this area, <it>P. falciparum </it>transmitted by mosquitoes of the <it>Anopheles gambiae </it>complex <abbrgrp><abbr bid="B28">28</abbr></abbrgrp>, is seasonal and usually occurs after the long and short rainy seasons.</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>Origin of <it>P. falciparum </it>clones used for <it>in vitro </it>culture</p>
               </caption>
               <tblbdy cols="4">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Clone</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Parent isolate</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Geographical origin</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Reference</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>3D7</p>
                     </c>
                     <c ca="left">
                        <p>NF54</p>
                     </c>
                     <c ca="left">
                        <p>Amsterdam airport -Netherlands (unknown origin)</p>
                     </c>
                     <c ca="left">
                        <p>(Walliker <it>et al</it>., 1987)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>A4</p>
                     </c>
                     <c ca="left">
                        <p>IT04</p>
                     </c>
                     <c ca="left">
                        <p>Brazil</p>
                     </c>
                     <c ca="left">
                        <p>(Roberts et al., 1992)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>C10</p>
                     </c>
                     <c ca="left">
                        <p>1776</p>
                     </c>
                     <c ca="left">
                        <p>Malaysia</p>
                     </c>
                     <c ca="left">
                        <p>(Ang <it>et al</it>., 1996)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>D10</p>
                     </c>
                     <c ca="left">
                        <p>FCQ-27</p>
                     </c>
                     <c ca="left">
                        <p>Papua New Guinea</p>
                     </c>
                     <c ca="left">
                        <p>(Chen <it>et al</it>., 1980)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Dd2</p>
                     </c>
                     <c ca="left">
                        <p>W2-MEF</p>
                     </c>
                     <c ca="left">
                        <p>Indochina</p>
                     </c>
                     <c ca="left">
                        <p>(Oduola <it>et al</it>., 1988)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>FcB1</p>
                     </c>
                     <c ca="left">
                        <p>Unknown</p>
                     </c>
                     <c ca="left">
                        <p>Colombia</p>
                     </c>
                     <c ca="left">
                        <p>(Schrevel <it>et al</it>., 1994)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>T9/96</p>
                     </c>
                     <c ca="left">
                        <p>T9</p>
                     </c>
                     <c ca="left">
                        <p>Thailand</p>
                     </c>
                     <c ca="left">
                        <p>(Thaithong <it>et al</it>., 1984)</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
            <p>This study was approved by the Institutional Ethical Review Board of Nanyang Technological University, Singapore, and by the Kenyan Medical Research Institute National Ethics Committee</p>
         </sec>
         <sec>
            <st>
               <p>Culture of <it>P. falciparum </it>laboratory lines and Kilifi isolates</p>
            </st>
            <p>Laboratory parasite lines were cultured in fresh human RBC (supplied by National UK Blood Donation Service) in RPMI 1640 complete medium supplemented with Albumax and 2 mM glutamine (Gibco) as previously described <abbrgrp><abbr bid="B29">29</abbr></abbrgrp>. Parasitaemia was monitored daily by microscopy examination of Giemsa stained thin blood smears.</p>
            <p><it>Plasmodium falciparum </it>parasite isolates from Kilifi were recovered from liquid nitrogen frozen stock and cultured in RPMI 1640 medium supplemented with 10% AB human serum (Kilifi General Hospital, Kenya), 2 mM L-glutamine (Gibco), 37.5 mM HEPES (Gibco), 20 mM Glucose, and 2 &#956;g/ml Gentamycin (Gibco). No fresh red blood cells (RBCs) were added and the parasites were maintained in culture for approximately 30 hours, or until they reached late trophozoite/schizont-stages. Parasite samples were separated into two fractions for later processing of parasite genomic DNA (gDNA) and RNA isolation.</p>
         </sec>
         <sec>
            <st>
               <p>Preparation of parasite genomic DNA (gDNA) and RNA</p>
            </st>
            <p><it>Plasmodium falciparum </it>iRBCs were pelleted at 560&#215; <it>g </it>for 5 minutes. Resulting pellets were stored at -80&#176;C in screw top cryovials. A phenol/chloroform extraction method was used for larger (greater than 500 &#956;l) iRBC pellets as previously described <abbrgrp><abbr bid="B30">30</abbr></abbrgrp>. The DNeasy<sup>&#174; </sup>kit (Qiagen) protocols 1 and 2 were used for small (less than 500 &#956;l) blood samples according to manufacturer's recommendations. Genomic DNA was resuspended in nuclease-free water.</p>
            <p>For RNA isolation, iRBC pellets (approximately 100 &#956;l) were lysed in 1 ml prewarmed (37&#176;C) Trizol LS reagent (Gibco Invitrogen) and then stored at -80&#176;C in screw top cryovials. RNA was extracted as described previously <abbrgrp><abbr bid="B31">31</abbr></abbrgrp>, using DNase I digestion (Invitrogen) to remove contaminating DNA. RNA was resuspended in nuclease-free water.</p>
         </sec>
         <sec>
            <st>
               <p>Primers designed for <it>stevor </it>specific PCR/RT-PCR</p>
            </st>
            <p>The primers were assessed using multiple sequence alignments to ensure that the chosen sequences were in regions conserved within the <it>stevor </it>gene family, but not in other genes (for example the <it>rif </it>gene family). A combination of two sets of primers in a nested PCR was used RepF1, RepF2 and RepR internal-PCR primers were designed as previously described <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>. The RepF1/2 primers were redesigned to remove an opal stop codon (TGA) replacing it with (TGC). The smf1/smr1 external primers were previously described <abbrgrp><abbr bid="B32">32</abbr></abbrgrp>. All primers were synthesized by Eurogentec/Oswel (Southampton, UK) or Research Biolabs (Singapore). The use of a nested-PCR protocol for RT-PCR was problematic due to amplification of contaminating gDNA, therefore a <it>stevor</it>-specific single step amplification was designed, facilitated by the complete genome sequence <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>, using the primers JBSTEVORF1 and JBSTEVORR1. Primers sequences are summarized in Table <tblr tid="T2">2</tblr>.</p>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Primers sequences</p>
               </caption>
               <tblbdy cols="4">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Primer name</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Direction</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Primer Sequence (5'-3')</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Tm (&#176;C)</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Smf1</p>
                     </c>
                     <c ca="left">
                        <p>sense</p>
                     </c>
                     <c ca="left">
                        <p>GAYSCAGAACTCAARGAAATWATT</p>
                     </c>
                     <c ca="left">
                        <p>46.42</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Smr1</p>
                     </c>
                     <c ca="left">
                        <p>antisense</p>
                     </c>
                     <c ca="left">
                        <p>GCAGMACCAAAGYWGYAATACC</p>
                     </c>
                     <c ca="left">
                        <p>47.9</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>JBSTEVORF1</p>
                     </c>
                     <c ca="left">
                        <p>sense</p>
                     </c>
                     <c ca="left">
                        <p>AGATGTACCCGTGGTATATGTTCTTGCA</p>
                     </c>
                     <c ca="left">
                        <p>54.96</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>JBSTEVORR1</p>
                     </c>
                     <c ca="left">
                        <p>antisense</p>
                     </c>
                     <c ca="left">
                        <p>GCTAATATAAGTAGAACCAAAGCTGCAATAC</p>
                     </c>
                     <c ca="left">
                        <p>54.44</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>RepF1</p>
                     </c>
                     <c ca="left">
                        <p>sense</p>
                     </c>
                     <c ca="left">
                        <p>AGATGAATTCGTGGTATATRTTYTTGYTC</p>
                     </c>
                     <c ca="left">
                        <p>55.84</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>RepF2</p>
                     </c>
                     <c ca="left">
                        <p>sense</p>
                     </c>
                     <c ca="left">
                        <p>AGATGAATTCGGGGTTTAGTTGTGTGTGC</p>
                     </c>
                     <c ca="left">
                        <p>63.86</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>RepR</p>
                     </c>
                     <c ca="left">
                        <p>antisense</p>
                     </c>
                     <c ca="left">
                        <p>TTTAGGATCCAGAACCAAARYTGCAATACC</p>
                     </c>
                     <c ca="left">
                        <p>62.21</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
            <p>DNA and RNA products were separated by electrophoresis in 1% multi purpose agarose (Roche) in 1&#215; Tris buffer contained 0.25 &#956;g/ml ethidium bromide to enable UV visualization. RNA gels contained 5 mM guanidine thiocyanate.</p>
         </sec>
         <sec>
            <st>
               <p>Small-scale preparation of plasmid DNA (minipreps)</p>
            </st>
            <p>Plasmid DNA was isolated using the QIAprep spin SNAP Miniprep<sup>&#174; </sup>Kit (Invitrogen). The QIAgen Maxiprep<sup>&#174; </sup>kit was used according to manufacturer's protocol to isolate larger quantities of pET-24a (+) vector.</p>
         </sec>
         <sec>
            <st>
               <p>Automated DNA Sequencing</p>
            </st>
            <p>Following DNA expansion, purification, and confirmation that a <it>stevor </it>insert was present; the DNA was then quantified by spectrophotometry, pelleted and dried before sequencing.</p>
            <p>Three systems have been used for sequencing reactions:</p>
            <p>a) The BigDye<sup>&#174; </sup>Terminator Cycle Sequencing Ready Reaction kit (Perkin-Elmer, Applied Biosystems, Warrington, UK) was used according to manufacturer's instructions. The reaction was carried out using approximately 600 ng of pCR<sup>&#174;</sup>2.1 or pCR<sup>&#174; </sup>II DNA (vector plus insert) per sample with either M13 forward or reverse primers in the Eppendorf Mastercycler. Unincorporated dye terminators were removed by ethanol precipitation. Samples were resuspended in 3 &#956;l loading dye 16.5% v/v Blue Dextran/EDTA (Applied Biosystems) in formamide (Amresco, Solon USA), followed by electrophoresis and data collection on the ABI PRISM&#8482; 377 DNA sequencer (Perkin -Elmer).</p>
            <p>b) The BigDye<sup>&#174; </sup>reactions were also used with T7 primers and pET-24a (+) DNA, or TrxFus forward or T7 reverse primers with pET102/D-TOPO DNA. Sequencing was performed at the National Neuroscience Institute, Singapore.</p>
            <p>c) The MegaBACE system (Amersham Biosciences) was used. The ABI PRISM<sup>&#174; </sup>BigDye<sup>&#174; </sup>Terminator v1.1 Cycle Sequencing kit (Applied Biosystems) cycle sequencing mix was used according to the manufacturer's protocols. Samples were ethanol precipitated before addition of MegaBACE&#8482; loading solution (Amersham Biosciences) and loading onto a MegaBACE 96-capillary machine.</p>
         </sec>
         <sec>
            <st>
               <p>Sequence alignment analysis (HVR region)</p>
            </st>
            <p>A fragment of approximately 280 base pairs (bp) was successfully isolated through PCR and RT-PCR amplification. However, due to the variant nature of the HVR, sequences varied in length, coding for a maximum of 82 amino acids. Clones have been obtained from multiple PCR reactions to reduce PCR bias, and were sequenced in forward and reverse directions. <it>P. falciparum </it>3D7, IT and Ghanaian isolates sequences were obtained from BLAST and Tools-oligo searches within PlasmoDB <abbrgrp><abbr bid="B33">33</abbr></abbrgrp>.</p>
            <p>Editing of nucleotide and amino acid (translated) sequences was carried out using the Autoassembler<sup>&#174;</sup>, Chromas<sup>&#174;</sup>, DNAstar (2001) freeware programmes. Sequences from different parasite sources and different amplification reactions were aligned by using ClustalX<sup>&#174; </sup><abbrgrp><abbr bid="B34">34</abbr></abbrgrp>, and Bioedit7.0.1<sup>&#174; </sup>softwares. Multiple alignments and their corresponding chromatograms were edited by eye for discrepancies and mistaken nucleotide assignment by the automated sequencing method. BLAST analysis, version 4.4 from PlasmoDB <abbrgrp><abbr bid="B33">33</abbr></abbrgrp> was used in order to confirm that DNA sequences were the result of the amplification of <it>stevor </it>exon-2 hyper-variable loop locus.</p>
         </sec>
         <sec>
            <st>
               <p>Phylogenetic analysis</p>
            </st>
            <p>Phylogenetic trees showing genetic distance were constructed using the following programmes: Molecular Evolutionary Genetics Analysis (MEGA) 2.1 or 3.0<sup>&#174;</sup>, PAUP version 4.0 <abbrgrp><abbr bid="B35">35</abbr><abbr bid="B36">36</abbr></abbrgrp>, and Tree view<sup>&#174; </sup><abbrgrp><abbr bid="B37">37</abbr></abbrgrp>. These programmes enable the construction of trees using three-building models: Neighbor-Joining, Maximum Parsimony and Maximum likelihood, taking into account the observed nucleotide frequency, substitution rate and transition/transversion ratio, based on Nei genetic distance estimates <abbrgrp><abbr bid="B35">35</abbr></abbrgrp>. The bootstrap analysis <abbrgrp><abbr bid="B38">38</abbr></abbrgrp> was used in order to statistically assign support to hypotheses of phylogenetic relationship among sequences estimated by the above-mentioned methods.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <sec>
            <st>
               <p>Identification of common <it>stevor </it>genes in laboratory lines and Kilifi field isolates</p>
            </st>
            <p>The <it>P. falciparum </it>genome sequencing project <abbrgrp><abbr bid="B2">2</abbr></abbrgrp> as well as subsequent sequencing efforts has given some insight into the diversity of <it>stevor </it>in different <it>P. falciparum </it>lines. Still these data are limited and, therefore, additional sequences from both established laboratory lines and freshly isolated parasite samples would provide valuable additional information. For this purpose, genomic DNA was extracted from five different laboratory lines of various geographic origins: A4; FcB1; C10; T9/96 and 3D7 (Table <tblr tid="T1">1</tblr>) and also from 10 representative blood samples taken from patients in the Kilifi region of Kenya.</p>
            <p>Genomic DNA was amplified using the previously described <it>stevor</it>-specific nested primers flanking the predicted hyper-variable loop region <abbrgrp><abbr bid="B32">32</abbr></abbrgrp> (Table <tblr tid="T2">2</tblr>). PCR from all laboratory lines (Figure <figr fid="F1">1A</figr>) as well as Kilifi isolates (Figure <figr fid="F1">1B</figr>) gave amplification products of the expected size (600 bp and 300 bp) indicating that these primers were able to amplify <it>stevor </it>sequences from both the laboratory lines and Kilifi field isolates. Similar to what was found with the <it>P. falciparum </it>3D7, more than one PCR product was detected in the expected size range, amplified by both the external (550&#8211;700 bp), and internal primers (250&#8211;350 bp) (Figure <figr fid="F1">1A</figr>). This is indicative of the amplification of multiple <it>stevor </it>sequences from both laboratory lines and field isolates. The 300 bp PCR products from the different samples were cloned and a number of clones were sequenced in both forward and reverse directions. The sequence data obtained here from genomic DNA was further expanded by the addition of the transcribed <it>stevor </it>sequences which had previously been obtained by RT-PCR from RNA extracted from the same original blood samples <abbrgrp><abbr bid="B39">39</abbr></abbrgrp>.</p>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>Agarose gel showing PCR products obtained from laboratory line and Kilifi isolate parasite genomic DNA</p>
               </caption>
               <text>
                  <p><b>Agarose gel showing PCR products obtained from laboratory line and Kilifi isolate parasite genomic DNA</b>. Gel electrophoresis of nested <it>stevor </it>PCR products from genomic DNA extracted from 5 representative <it>P. falciparum </it>laboratory lines: A4; FcB1; C10; T9/96; and 3D7 (A) and 10 representative Kilifi parasite isolates (B). 5 &#956;l of each product was loaded onto a 2.5% agarose gel. Results show two amplicons in the expected size ranges, products carried over in the nested PCR-step from the external PCR (approximately 600 bp) with primers smf1 and smr1, and internal PCR products (approximately 300 bp) from primers RepF1/2 and RepR. 100 bp marker (Fermentas) is shown. dH<sub>2</sub>O = negative control containing sterile water instead of template DNA.</p>
               </text>
               <graphic file="1475-2875-8-140-1"/>
            </fig>
            <p>Despite the low throughput approach, a total of 213 genomic DNA and RNA products were successfully sequenced, 133 were unique DNA sequences [see Additional file <supplr sid="S1">1</supplr>] coding for 108 unique amino acid sequences. Comparison with known STEVOR sequences confirmed that the PCR and RT-PCR products indeed represented STEVOR. The number of times each sequence was obtained per isolate is shown (Figure <figr fid="F2">2A</figr>). Overall, six different <it>stevor </it>sequences were identified from genomic DNA in the reference 3D7 clone isolated in The Netherlands but of unknown geographic origin <abbrgrp><abbr bid="B40">40</abbr></abbrgrp> that had been included as a positive control. Interestingly, two (3D7_2_41202 and 3D7_1_181202) of the sequences obtained from the 3D7 clone maintained at the NIMR in London were absent from the published 3D7 genome <it>stevor </it>repertoire (Figure <figr fid="F2">2A</figr>). All other <it>stevor </it>sequences present in the 3D7 genome are shown with their gene identification number for the purpose of comparison. Of the 133 unique <it>stevor </it>DNA sequences, twenty-one were found to be present in more than one parasite line or isolate (Figure <figr fid="F2">2A</figr>, asterisk), five (5) of these paralogues were identified in A4, C10, FcB1 and D10 (blue asterisk), six (6) were found in A4, C10 and FcB1 (green asterisk), three (3) were found in T9/96, C10 and A4 (orange asterisk), while two (2) were found in 3D7 and T9/96 (red asterisk), 3D7 and A4 (brown asterisk) as well as K11 and K14 (black asterisk). Finally a single sequence was found as part of the 3D7 genome and K1640 (Figure <figr fid="F2">2A</figr>, pink asterisk). The highly represented <it>stevor </it>sequences most likely represent "common" <it>stevor </it>that can be found in a variety of parasite isolates from around the world. For a number of these more common <it>stevor </it>transcription was also detected by RT-PCR indicating that these genes are of potential functional relevance.</p>
            <suppl id="S1">
               <title>
                  <p>Additional file 1</p>
               </title>
               <text>
                  <p><b>Stevor DNA sequences</b>. The data provided represent nucleotide sequences of clones obtained from PCR and RT-PCR reactions of lab strains and field isolates.</p>
               </text>
               <file name="1475-2875-8-140-S1.xls">
                  <p>Click here for file</p>
               </file>
            </suppl>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>Identification of <it>stevor </it>sequences per parasite isolate</p>
               </caption>
               <text>
                  <p><b>Identification of <it>stevor </it>sequences per parasite isolate</b>. A) Number of different <it>stevor </it>obtained from parasite DNA and RNA. Parasite isolates are shown in different colors below the graph. The sequence name is denoted along the x-axis, each sequence has a unique identifier consisting of the parasite isolate (+ if amplified from RNA), clone number and date. The number of clones per sequence is shown on the y-axis. <it>P. falciparum </it>3D7 genomic <it>stevor </it>sequences are included for comparison (solid black). B) Representation of the different transcribed (+) <it>stevor </it>obtained in this study.</p>
               </text>
               <graphic file="1475-2875-8-140-2"/>
            </fig>
            <p>From this initial analysis it is clear that there are a number of <it>stevor </it>sequences that are common to a number of different laboratory lines; in contrast only a single sequence (K1640_1_BD141105) from a Kilifi isolate was found to be identical to a gene (PFL2610w) from the 3D7 genome. In contrast despite the large number of <it>stevor </it>sequences identified in the Kilifi isolates, only a single <it>stevor </it>sequence was found to be present in more than one isolate. This particular sequence was transcribed in both K11 (K11+_111104) and K14 (K14+_1_111104) parasites (Figure <figr fid="F2">2B</figr>).</p>
            <p>The RT-PCR data indicate that <it>stevor </it>is transcribed in all the <it>P. falciparum </it>lines examined with the exception of the parasite clone A4, supporting previous observations that this parasite clone does not transcribe nor express STEVOR <abbrgrp><abbr bid="B4">4</abbr><abbr bid="B39">39</abbr></abbrgrp>. This lack of STEVOR expression in the A4 parasite is not due to the absence of the genetic information as this clone contains at least 20 different <it>stevor </it>genes (Figure <figr fid="F2">2A</figr>). In line with published observations <abbrgrp><abbr bid="B21">21</abbr></abbrgrp> that field isolates transcribe multiple <it>var </it>at the same time, numerous unique <it>stevor </it>transcripts were also detected in both laboratory and patient samples (Figure <figr fid="F2">2B</figr>).</p>
         </sec>
         <sec>
            <st>
               <p>Conservation of <it>stevor </it>across different parasite lines</p>
            </st>
            <p>The observation that identical HVR sequences could be found in different parasite lines raised the possibility that <it>stevor </it>could be grouped into distinct subgroups with different biological functions, similar to the <it>rif </it>and <it>pir </it>multigene family <abbrgrp><abbr bid="B25">25</abbr><abbr bid="B41">41</abbr><abbr bid="B42">42</abbr></abbrgrp>. For this purpose the sequences identified here, together with the corresponding regions from the 3D7 <it>stevor </it>repertoire were clustered into similarity groups by constructing a Neighbor Joining as well as a Minimum Evolution Tree (Figure <figr fid="F3">3</figr>).</p>
            <fig id="F3">
               <title>
                  <p>Figure 3</p>
               </title>
               <caption>
                  <p>Phylogenetic trees of <it>stevor </it>DNA sequences</p>
               </caption>
               <text>
                  <p><b>Phylogenetic trees of <it>stevor </it>DNA sequences</b>. Neighbor-joining (A) and Minimum Evolution (B) methods were used for generation of phylogenetic trees of 152 HVR <it>stevor </it>alleles. Trees are based upon a nucleotide alignment of the HVRs and condensed to show only those branches with a bootstrap value of 95% significance and above. Sequences are color-coded according to originating isolate: Kilifi-yellow; T9/96-dark blue; 3D7-pink; A4 and C10-green; FcB1-light blue; D10-light green. Orange open-circle around a branch point indicates the major <it>stevor </it>sub-grouping, blue open-circles highlight T9/96 sub-groups, green open-circles highlight sub-groupings including FcB1, C10 and A4 sequences, yellow open-circles highlight Kilifi sequence sub-groupings.</p>
               </text>
               <graphic file="1475-2875-8-140-3"/>
            </fig>
            <p>The Neighbor Joining tree (Figure <figr fid="F3">3A</figr>) clustered the 152 HVR DNA sequences into two groups with one large sub-group containing approximately one-third of the <it>stevor </it>sequences (Figure <figr fid="F3">3A</figr>, orange branch). This subgroup contained sequences from all parasites except the D10 laboratory line and the K14, K11 and K6 Kilifi field isolates. At this stage it is not clear whether the absence of this subgroup of <it>stevor </it>in these parasites is a reflection of the limited sequence data available or truly represents a lack of this subgroup. It is also interesting to note that there is further sub-clustering of sequences within this branch, where clusters either contain sequences from the same line or alternatively from a number of different parasites. The second large group containing the remaining two-thirds of <it>stevor </it>sequences appears to contain numerous branch points of related sequences rather than containing a single defined cluster. These data would indicate that overall the sequence divergence is much higher in this group. Sequences obtained from a single parasite line also appear to form distinct clusters, with each cluster containing a number of different related sequences. This can be clearly seen for T9/96 <it>stevor </it>(Figure <figr fid="F3">3A</figr>, blue circles) that contains at least three distinct clusters. Similar clustering is also seen for sequences from A4, C10, FcB1 and D10 with the majority of sequences falling within just four sub-groups (Figure <figr fid="F3">3A</figr>, green circles) while the majority of Kilifi isolates <it>stevor </it>sequences were contained within seven clusters (Figure <figr fid="F3">3A</figr>, yellow circles). Importantly, these specific sequence clusters often also contain sequences from other parasite lines or isolates indicating that they do not result from a specific phylogenetic branch. Rather it appears that while there is a trend for some sequences from the same parasite to cluster together, most are distributed across the tree and cluster with sequences from other strains. To further validate these findings, the <it>stevor </it>sequences were clustered using the Minimum Evolution tree construction method at 95% significance bootstrap values (Figure <figr fid="F3">3B</figr>). This approach produced the same clusters as the Neighbor Joining method (compare Figure <figr fid="F3">3A</figr> with <figr fid="F3">3B</figr>). The 3D7 <it>stevor </it>repertoire is distributed throughout the trees (Figure <figr fid="F3">3A, B</figr>; pink points) with clusters containing a maximum of two 3D7 sequences.</p>
            <p>To assess whether or not this clustering of <it>stevor </it>DNA sequences is maintained at the amino acid level, 108 unique STEVOR amino acid sequences were used to construct a Neighbor Joining as well as a Minimum Evolution Tree with a bootstrap value of 85% or higher (Figure <figr fid="F4">4A, B</figr>). The two approaches resulted in nearly identical trees with a number of broad clusters containing sequences from different lines and isolates. Using this analysis a single major sub-group was observed (highlighted by an orange circle) reflecting an apparent trend for sequences of the same geographic region to be more closely related (Figure <figr fid="F4">4A, B</figr>). More precisely, one obvious cluster was observed containing majority of Kilifi protein sequences (Figure <figr fid="F4">4A</figr>, orange circle, yellow points). However, as already identified in the DNA sequence trees, clusters are not completely exclusive and a number of sequences from laboratory lines are found within this cluster (Figure <figr fid="F4">4A</figr>, orange circle, green, pink, blue and light blue points). Conversely a number of Kilifi isolate sequences are found distributed across the other branches of the tree where they cluster both with other Kilifi sequences as well as sequences from a range of laboratory lines (Figure <figr fid="F4">4</figr>, yellow points).</p>
            <fig id="F4">
               <title>
                  <p>Figure 4</p>
               </title>
               <caption>
                  <p>Phylogenetic trees of <it>stevor </it>HVR protein sequences</p>
               </caption>
               <text>
                  <p><b>Phylogenetic trees of <it>stevor </it>HVR protein sequences</b>. Unrooted phylogenetic trees using neighbor-joining and minimum evolution methods showing all branches (A) and 85% condensed trees (B) using 108 amino acid sequences. Trees are based upon an alignment of the HVRs then condensed to show only those branches with a bootstrap value of 85% significance and above.</p>
               </text>
               <graphic file="1475-2875-8-140-4"/>
            </fig>
            <p>Similar to the outcome of the DNA sequence analysis, the T9/96 amino acid sequences clustered within three small sub-groups (Figure <figr fid="F4">4</figr>, blue circles) while sequences from laboratory lines A4 (green), C10 (green), FcB1 (light blue) could be found dispersed in different clusters on the tree (Figure <figr fid="F4">4</figr>). Interestingly, the significant clustering seen within the trees produced from the nucleotide sequences (Figure <figr fid="F3">3</figr>) was also maintained at the amino acid level. This clustering is consistent using either of two methods for generating the phylogenetic trees.</p>
            <p>This analysis was further extended to include all STEVOR sequences including those from published databases (IT and Ghanaian isolates) and 75 South American region sequences obtained from Albrecht <it>et al</it>. (2006)<abbrgrp><abbr bid="B18">18</abbr></abbrgrp>. A total of 226 HVR amino acid sequences were used for the analysis (Figure <figr fid="F5">5</figr>). However, no obvious cluster was observed, though a number of non-significant groups were present when the tree was condensed at 50% bootstrap values. The high divergence within the HVR encoding the predicted erythrocyte surface-exposed region of the STEVOR family is likely in response to host immunity.</p>
            <fig id="F5">
               <title>
                  <p>Figure 5</p>
               </title>
               <caption>
                  <p>50% condensed tree using 226 amino acid sequences</p>
               </caption>
               <text>
                  <p><b>50% condensed tree using 226 amino acid sequences</b>. Sequences are color-coded according to originating isolate: Kilifi field isolates-yellow; T9/96-dark blue; 3D7-pink; A4 and C10-green; FcB1-light blue; D10-light green, IT-black, Ghanaian field isolate-red. Orange open-circle indicates a major <it>stevor </it>sub-group, blue open-circles highlight T9/96 sub-groups, green open-circles highlight sub-groupings including FcB1, C10 and A4 sequences, yellow open-circles highlight Kilifi sequence sub-groupings.</p>
               </text>
               <graphic file="1475-2875-8-140-5"/>
            </fig>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Discussion</p>
         </st>
         <p>The human malaria parasite <it>P. falciparum </it>is able to evade the host's immune response by expressing a range of variable antigens on the surface of the infected erythrocyte. Several genes are potentially involved in this process with the <it>var</it>, <it>rif </it>and <it>stevor </it><abbrgrp><abbr bid="B2">2</abbr></abbrgrp> multigene families being the most likely candidates and coding for rapidly evolving proteins. The rapid changes are believed to result from a strong immune-mediated diversifying selection <abbrgrp><abbr bid="B19">19</abbr><abbr bid="B43">43</abbr><abbr bid="B44">44</abbr></abbrgrp>.</p>
         <p>In this study, the <it>stevor </it>sequence repertoire and diversity were analysed in laboratory lines and Kilifi field isolates. As expected the <it>stevor </it>family was found in all <it>P. falciparum </it>genomes and was transcribed in all field and laboratory parasites (exception for the A4 clone) with multiple transcripts being detected. This result is in line with previous studies in which numerous <it>var </it>as well as <it>stevor </it>transcripts were detected in single patient samples using a microarray <abbrgrp><abbr bid="B45">45</abbr></abbrgrp>. From the RT-PCR and sequencing data it is clear that both in cultured laboratory lines and in patient samples a significant proportion of the <it>stevor </it>repertoire is transcribed at the same time. In isolate K5 a total of 16 different sequences were detected; and despite the close phylogenetic relationship between these sequences (Figure <figr fid="F3">3</figr>) at this stage it can not be ruled out that these transcripts arose from a multiclonal infection.</p>
         <p>Recent phylogenetic studies have shown that the <it>rif </it>family form two clear subgroups <abbrgrp><abbr bid="B24">24</abbr></abbrgrp> that potentially can be further divided into functionally distinct subgroups <abbrgrp><abbr bid="B46">46</abbr></abbrgrp>. This is clearly not the case for <it>stevor </it>where the presence of distinct subgroups is not that strongly supported. Still there is sufficient evidence to support some clustering into different groups. Importantly, the identification of identical sequences in laboratory lines from different geographic regions as well as field samples would imply some functional constraints acting upon this sequence. In addition sequences within the Kilifi isolates appear to be more closely related to each other than to any of the laboratory parasites, and no common <it>stevor </it>were found between Kilifi except for a single <it>stevor </it>sequence shared between one Kilifi isolate and 3D7. The <it>stevor </it>sequence found in two Kilifi isolates (K11 and K14) may represent a common sequence detected in the two isolates and also seen in a number of laboratory lines.</p>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>Conserved genes were identified in different <it>P. falciparum </it>isolates from different global locations for example: A4, C10 and FcB1 in particular, contain several closely related <it>stevor </it>genes, suggesting that the ancestral <it>P. falciparum </it>parasite genome already had multiple <it>stevor </it>genes that may have subsequently diversified further within the different <it>P. falciparum </it>populations. The high sequence variability observed is consistent with the HVR of STEVOR being under strong selection pressure. On the other hand, there is only weak evidence that STEVOR like the RIFIN can be subdivided into distinct phylogenetic subgroups implying that STEVOR function has less diversified in <it>P. falciparum</it>.</p>
      </sec>
      <sec>
         <st>
            <p>Competing interests</p>
         </st>
         <p>The authors declare that they have no competing interests.</p>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>JEB carried out molecular biology studies and wrote the paper. MN analysed the data and wrote the paper. AAH, KM and JL participated in the design and coordination of the study and helped to draft the manuscript. PRP conceived the study, and participated in its design and coordination and wrote the paper. All authors read and approved the final manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>We like to thank Pete Bull and Vandana Thathy for critical reading of the manuscript. JEB was in receipt of a studentship from the Medical Research Council (UK). This work was supported by a Biomedical Research Council (BMRC) Singapore Grant (04/1/22/19/364 and 07/1/22/19/514) and the BioMalPar European Network of Excellence supported by a European grant (LSHP-CT-2004-503578) from Priority 1 "Life Sciences, Genomics and Biotechnology for Health" in the 6th Framework Programme.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>The global distribution of clinical episodes of <it>Plasmodium falciparum </it>malaria</p>
            </title>
            <aug>
               <au>
                  <snm>Snow</snm>
                  <fnm>RW</fnm>
               </au>
               <au>
                  <snm>Guerra</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Noor</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Myint</snm>
                  <fnm>HY</fnm>
               </au>
               <au>
                  <snm>Hay</snm>
                  <fnm>SI</fnm>
               </au>
            </aug>
            <source>Nature. </source>
            <pubdate>2005</pubdate>
            <volume>434</volume>
            <issue>7030</issue>
            <fpage>214</fpage>
            <lpage>217</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nature03342</pubid>
                  <pubid idtype="pmpid" link="fulltext">15759000</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>Genome sequence of the human malaria parasite <it>Plasmodium falciparum</it></p>
            </title>
            <aug>
               <au>
                  <snm>Gardner</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Hall</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Fung</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>White</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Berriman</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Hyman</snm>
                  <fnm>RW</fnm>
               </au>
               <au>
                  <snm>Carlton</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Pain</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Nelson</snm>
                  <fnm>KE</fnm>
               </au>
               <au>
                  <snm>Bowman</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Paulsen</snm>
                  <fnm>IT</fnm>
               </au>
               <au>
                  <snm>James</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Eisen</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Rutherford</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Salzberg</snm>
                  <fnm>SL</fnm>
               </au>
               <au>
                  <snm>Craig</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Kyes</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Chan</snm>
                  <fnm>MS</fnm>
               </au>
               <au>
                  <snm>Nene</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Shallom</snm>
                  <fnm>SJ</fnm>
               </au>
               <au>
                  <snm>Suh</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Peterson</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Angiuoli</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Pertea</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Allen</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Selengut</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Haft</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Mather</snm>
                  <fnm>MW</fnm>
               </au>
               <au>
                  <snm>Vaidya</snm>
                  <fnm>AB</fnm>
               </au>
               <au>
                  <snm>Martin</snm>
                  <fnm>DM</fnm>
               </au>
               <au>
                  <snm>Fairlamb</snm>
                  <fnm>AH</fnm>
               </au>
               <au>
                  <snm>Fraunholz</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Roos</snm>
                  <fnm>DS</fnm>
               </au>
               <au>
                  <snm>Ralph</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>McFadden</snm>
                  <fnm>GI</fnm>
               </au>
               <au>
                  <snm>Cummings</snm>
                  <fnm>LM</fnm>
               </au>
               <au>
                  <snm>Subramanian</snm>
                  <fnm>GM</fnm>
               </au>
               <au>
                  <snm>Mungall</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Venter</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Carucci</snm>
                  <fnm>DJ</fnm>
               </au>
               <au>
                  <snm>Hoffman</snm>
                  <fnm>SL</fnm>
               </au>
               <au>
                  <snm>Newbold</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Davis</snm>
                  <fnm>RW</fnm>
               </au>
               <au>
                  <snm>Fraser</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Barrell</snm>
                  <fnm>B</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>2002</pubdate>
            <volume>419</volume>
            <fpage>498</fpage>
            <lpage>511</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">12368864</pubid>
                  <pubid idtype="doi">10.1038/nature01097</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>Rifins: a second family of clonally variant proteins expressed on the surface of red cells infected with <it>Plasmodium falciparum</it></p>
            </title>
            <aug>
               <au>
                  <snm>Kyes</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Rowe</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Kriek</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Newbold</snm>
                  <fnm>CI</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci U S A. </source>
            <pubdate>1999</pubdate>
            <volume>96</volume>
            <issue>16</issue>
            <fpage>9333</fpage>
            <lpage>9338</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1073/pnas.96.16.9333</pubid>
                  <pubid idtype="pmpid" link="fulltext">10430943</pubid>
                  <pubid idtype="pmcid">17783</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>The <it>Plasmodium falciparum </it>STEVOR multigene family mediates antigenic variation of the infected erythrocyte</p>
            </title>
            <aug>
               <au>
                  <snm>Niang</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Yan Yam</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Preiser</snm>
                  <fnm>PR</fnm>
               </au>
            </aug>
            <source>PLoS Pathog. </source>
            <pubdate>2009</pubdate>
            <volume>5</volume>
            <issue>2</issue>
            <fpage>e1000307</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1371/journal.ppat.1000307</pubid>
                  <pubid idtype="pmpid" link="fulltext">19229319</pubid>
                  <pubid idtype="pmcid">2637975</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>A Plasmodium gene family encoding Maurer's cleft membrane proteins: structural properties and expression profiling</p>
            </title>
            <aug>
               <au>
                  <snm>Sam-Yellowe</snm>
                  <fnm>TY</fnm>
               </au>
               <au>
                  <snm>Florens</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Johnson</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Wang</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Drazba</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Le Roch</snm>
                  <fnm>KG</fnm>
               </au>
               <au>
                  <snm>Zhou</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Batalov</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Carucci</snm>
                  <fnm>DJ</fnm>
               </au>
               <au>
                  <snm>Winzeler</snm>
                  <fnm>EA</fnm>
               </au>
               <au>
                  <snm>Yates</snm>
                  <fnm>JR</fnm>
                  <suf>3rd</suf>
               </au>
            </aug>
            <source>Genome Res. </source>
            <pubdate>2004</pubdate>
            <volume>14</volume>
            <issue>6</issue>
            <fpage>1052</fpage>
            <lpage>1059</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1101/gr.2126104</pubid>
                  <pubid idtype="pmpid" link="fulltext">15140830</pubid>
                  <pubid idtype="pmcid">419783</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>The chromosomal organization of the <it>Plasmodium falciparum </it>var gene family is conserved</p>
            </title>
            <aug>
               <au>
                  <snm>Thompson</snm>
                  <fnm>JK</fnm>
               </au>
               <au>
                  <snm>Rubio</snm>
                  <fnm>JP</fnm>
               </au>
               <au>
                  <snm>Caruana</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Brockman</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Wickham</snm>
                  <fnm>ME</fnm>
               </au>
               <au>
                  <snm>Cowman</snm>
                  <fnm>AF</fnm>
               </au>
            </aug>
            <source>Mol Biochem Parasitol. </source>
            <pubdate>1997</pubdate>
            <volume>87</volume>
            <issue>1</issue>
            <fpage>49</fpage>
            <lpage>60</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0166-6851(97)00041-8</pubid>
                  <pubid idtype="pmpid" link="fulltext">9233672</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Frequent ectopic recombination of virulence factor genes in telomeric chromosome clusters of P. falciparum</p>
            </title>
            <aug>
               <au>
                  <snm>Freitas-Junior</snm>
                  <fnm>LH</fnm>
               </au>
               <au>
                  <snm>Bottius</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Pirrit</snm>
                  <fnm>LA</fnm>
               </au>
               <au>
                  <snm>Deitsch</snm>
                  <fnm>KW</fnm>
               </au>
               <au>
                  <snm>Scheidig</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Guinet</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Nehrbass</snm>
                  <fnm>U</fnm>
               </au>
               <au>
                  <snm>Wellems</snm>
                  <fnm>TE</fnm>
               </au>
               <au>
                  <snm>Scherf</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>2000</pubdate>
            <volume>407</volume>
            <fpage>1018</fpage>
            <lpage>1022</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">11069183</pubid>
                  <pubid idtype="doi">10.1038/35039531</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Compartmentalization of genes coding for immunodominant antigens to fragile chromosome ends leads to dispersed subtelomeric gene families and rapid gene evolution in <it>Plasmodium falciparum</it></p>
            </title>
            <aug>
               <au>
                  <snm>Hernandez-Rivas</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Hinterberg</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Scherf</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Mol Biochem Parasitol</source>
            <pubdate>1996</pubdate>
            <volume>78</volume>
            <fpage>137</fpage>
            <lpage>148</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid">8813684</pubid>
                  <pubid idtype="doi">10.1016/S0166-6851(96)02618-7</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Molecular aspects of malaria pathogenesis</p>
            </title>
            <aug>
               <au>
                  <snm>Rasti</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Wahlgren</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Chen</snm>
                  <fnm>Q</fnm>
               </au>
            </aug>
            <source>FEMS Immunol Med Microbiol</source>
            <pubdate>2004</pubdate>
            <volume>41</volume>
            <fpage>9</fpage>
            <lpage>26</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">15094163</pubid>
                  <pubid idtype="doi">10.1016/j.femsim.2004.01.010</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Cloning the <it>P. falciparum </it>gene encoding PfEMP1, a malarial variant antigen and adherence receptor on the surface of parasitized human erythrocytes</p>
            </title>
            <aug>
               <au>
                  <snm>Baruch</snm>
                  <fnm>DI</fnm>
               </au>
               <au>
                  <snm>Pasloske</snm>
                  <fnm>BL</fnm>
               </au>
               <au>
                  <snm>Singh</snm>
                  <fnm>HB</fnm>
               </au>
               <au>
                  <snm>Bi</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Ma</snm>
                  <fnm>XC</fnm>
               </au>
               <au>
                  <snm>Feldman</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Taraschi</snm>
                  <fnm>TF</fnm>
               </au>
               <au>
                  <snm>Howard</snm>
                  <fnm>RJ</fnm>
               </au>
            </aug>
            <source>Cell. </source>
            <pubdate>1995</pubdate>
            <volume>82</volume>
            <issue>1</issue>
            <fpage>77</fpage>
            <lpage>87</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0092-8674(95)90054-3</pubid>
                  <pubid idtype="pmpid" link="fulltext">7541722</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Switches in expression of <it>Plasmodium falciparum </it>var genes correlate with changes in antigenic and cytoadherent phenotypes of infected erythrocytes</p>
            </title>
            <aug>
               <au>
                  <snm>Smith</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Chitnis</snm>
                  <fnm>CE</fnm>
               </au>
               <au>
                  <snm>Craig</snm>
                  <fnm>AG</fnm>
               </au>
               <au>
                  <snm>Roberts</snm>
                  <fnm>DJ</fnm>
               </au>
               <au>
                  <snm>Hudson-Taylor</snm>
                  <fnm>DE</fnm>
               </au>
               <au>
                  <snm>Peterson</snm>
                  <fnm>DS</fnm>
               </au>
               <au>
                  <snm>Pinches</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Newbold</snm>
                  <fnm>CI</fnm>
               </au>
               <au>
                  <snm>Miller</snm>
                  <fnm>LH</fnm>
               </au>
            </aug>
            <source>Cell</source>
            <pubdate>1995</pubdate>
            <volume>82</volume>
            <fpage>101</fpage>
            <lpage>110</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">7606775</pubid>
                  <pubid idtype="doi">10.1016/0092-8674(95)90056-X</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>The large diverse gene family var encodes proteins involved in cytoadherence and antigenic variation of <it>Plasmodium falciparum</it>-infected erythrocytes</p>
            </title>
            <aug>
               <au>
                  <snm>Su</snm>
                  <fnm>XZ</fnm>
               </au>
               <au>
                  <snm>Heatwole</snm>
                  <fnm>VM</fnm>
               </au>
               <au>
                  <snm>Wertheimer</snm>
                  <fnm>SP</fnm>
               </au>
               <au>
                  <snm>Guinet</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Herrfeldt</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Peterson</snm>
                  <fnm>DS</fnm>
               </au>
               <au>
                  <snm>Ravetch</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Wellems</snm>
                  <fnm>TE</fnm>
               </au>
            </aug>
            <source>Cell. </source>
            <pubdate>1995</pubdate>
            <volume>82</volume>
            <issue>1</issue>
            <fpage>89</fpage>
            <lpage>100</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0092-8674(95)90055-1</pubid>
                  <pubid idtype="pmpid" link="fulltext">7606788</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p><it>Plasmodium falciparum </it>domain mediating adhesion to chondroitin sulfate A: a receptor for human placental infection</p>
            </title>
            <aug>
               <au>
                  <snm>Buffet</snm>
                  <fnm>PA</fnm>
               </au>
               <au>
                  <snm>Gamain</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Scheidig</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Baruch</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Smith</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Hernandez-Rivas</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Pouvelle</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Oishi</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Fujii</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Fusai</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Parzy</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Miller</snm>
                  <fnm>LH</fnm>
               </au>
               <au>
                  <snm>Gysin</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Scherf</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>1999</pubdate>
            <volume>96</volume>
            <fpage>12743</fpage>
            <lpage>12748</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">10535993</pubid>
                  <pubid idtype="doi">10.1073/pnas.96.22.12743</pubid>
                  <pubid idtype="pmcid">23079</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p><it>Plasmodium falciparum </it>rosetting mediated by a parasite-variant erythrocyte membrane protein and complement-receptor 1</p>
            </title>
            <aug>
               <au>
                  <snm>Rowe</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Moulds</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Newbold</snm>
                  <fnm>CI</fnm>
               </au>
               <au>
                  <snm>Miller</snm>
                  <fnm>LH</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>1997</pubdate>
            <volume>388</volume>
            <fpage>292</fpage>
            <lpage>295</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">9230440</pubid>
                  <pubid idtype="doi">10.1038/40269</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Pfam: clans, web tools and services</p>
            </title>
            <aug>
               <au>
                  <snm>Finn</snm>
                  <fnm>RD</fnm>
               </au>
               <au>
                  <snm>Mistry</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Schuster-Bockler</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Griffiths-Jones</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Hollich</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Lassmann</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Moxon</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Marshall</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Khanna</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Durbin</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Eddy</snm>
                  <fnm>SR</fnm>
               </au>
               <au>
                  <snm>Sonnhammer</snm>
                  <fnm>EL</fnm>
               </au>
               <au>
                  <snm>Bateman</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>2006</pubdate>
            <volume>34</volume>
            <fpage>D247</fpage>
            <lpage>251</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">16381856</pubid>
                  <pubid idtype="doi">10.1093/nar/gkj149</pubid>
                  <pubid idtype="pmcid">1347511</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>stevor and rif are <it>Plasmodium falciparum </it>multicopy gene families which potentially encode variant antigens</p>
            </title>
            <aug>
               <au>
                  <snm>Cheng</snm>
                  <fnm>Q</fnm>
               </au>
               <au>
                  <snm>Cloonan</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Fischer</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Thompson</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Waine</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Lanzer</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Saul</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Mol Biochem Parasitol</source>
            <pubdate>1998</pubdate>
            <volume>97</volume>
            <fpage>161</fpage>
            <lpage>176</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">9879895</pubid>
                  <pubid idtype="doi">10.1016/S0166-6851(98)00144-3</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Chromosome 2 sequence of the human malaria parasite <it>Plasmodium falciparum</it></p>
            </title>
            <aug>
               <au>
                  <snm>Gardner</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Tettelin</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Carucci</snm>
                  <fnm>DJ</fnm>
               </au>
               <au>
                  <snm>Cummings</snm>
                  <fnm>LM</fnm>
               </au>
               <au>
                  <snm>Aravind</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Koonin</snm>
                  <fnm>EV</fnm>
               </au>
               <au>
                  <snm>Shallom</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Mason</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Yu</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Fujii</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Pederson</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Shen</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Jing</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Aston</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Lai</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Schwartz</snm>
                  <fnm>DC</fnm>
               </au>
               <au>
                  <snm>Pertea</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Salzberg</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Zhou</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Sutton</snm>
                  <fnm>GG</fnm>
               </au>
               <au>
                  <snm>Clayton</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>White</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Smith</snm>
                  <fnm>HO</fnm>
               </au>
               <au>
                  <snm>Fraser</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Adams</snm>
                  <fnm>MD</fnm>
               </au>
               <au>
                  <snm>Venter</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Hoffman</snm>
                  <fnm>SL</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>1998</pubdate>
            <volume>282</volume>
            <fpage>1126</fpage>
            <lpage>1132</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">9804551</pubid>
                  <pubid idtype="doi">10.1126/science.282.5391.1126</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>Extense variant gene family repertoire overlap in Western Amazon <it>Plasmodium falciparum </it>isolates</p>
            </title>
            <aug>
               <au>
                  <snm>Albrecht</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Merino</snm>
                  <fnm>EF</fnm>
               </au>
               <au>
                  <snm>Hoffmann</snm>
                  <fnm>EH</fnm>
               </au>
               <au>
                  <snm>Ferreira</snm>
                  <fnm>MU</fnm>
               </au>
               <au>
                  <snm>de Mattos Ferreira</snm>
                  <fnm>RG</fnm>
               </au>
               <au>
                  <snm>Osakabe</snm>
                  <fnm>AL</fnm>
               </au>
               <au>
                  <snm>Dalla Martha</snm>
                  <fnm>RC</fnm>
               </au>
               <au>
                  <snm>Ramharter</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Durham</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Ferreira</snm>
                  <fnm>JE</fnm>
               </au>
               <au>
                  <snm>Del Portillo</snm>
                  <fnm>HA</fnm>
               </au>
               <au>
                  <snm>Wunderlich</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Mol Biochem Parasitol. </source>
            <pubdate>2006</pubdate>
            <volume>150</volume>
            <issue>2</issue>
            <fpage>157</fpage>
            <lpage>165</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.molbiopara.2006.07.007</pubid>
                  <pubid idtype="pmpid" link="fulltext">16938359</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Hypervariability within the Rifin, Stevor and Pfmc-2TM superfamilies in <it>Plasmodium falciparum</it></p>
            </title>
            <aug>
               <au>
                  <snm>Lavazec</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Sanyal</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Templeton</snm>
                  <fnm>TJ</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>2006</pubdate>
            <volume>34</volume>
            <fpage>6696</fpage>
            <lpage>6707</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">17148488</pubid>
                  <pubid idtype="doi">10.1093/nar/gkl942</pubid>
                  <pubid idtype="pmcid">1751529</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Genetic diversity and chloroquine selective sweeps in <it>Plasmodium falciparum</it></p>
            </title>
            <aug>
               <au>
                  <snm>Wootton</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Feng</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Ferdig</snm>
                  <fnm>MT</fnm>
               </au>
               <au>
                  <snm>Cooper</snm>
                  <fnm>RA</fnm>
               </au>
               <au>
                  <snm>Mu</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Baruch</snm>
                  <fnm>DI</fnm>
               </au>
               <au>
                  <snm>Magill</snm>
                  <fnm>AJ</fnm>
               </au>
               <au>
                  <snm>Su</snm>
                  <fnm>XZ</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>2002</pubdate>
            <volume>418</volume>
            <fpage>320</fpage>
            <lpage>323</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">12124623</pubid>
                  <pubid idtype="doi">10.1038/nature00813</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Plasmodium falciparum variant surface antigen expression patterns during malaria</p>
            </title>
            <aug>
               <au>
                  <snm>Bull</snm>
                  <fnm>PC</fnm>
               </au>
               <au>
                  <snm>Berriman</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Kyes</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Quail</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Hall</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Kortok</snm>
                  <fnm>MM</fnm>
               </au>
               <au>
                  <snm>Marsh</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Newbold</snm>
                  <fnm>CI</fnm>
               </au>
            </aug>
            <source>PLoS Pathog</source>
            <pubdate>2005</pubdate>
            <volume>1</volume>
            <fpage>e26</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">16304608</pubid>
                  <pubid idtype="doi">10.1371/journal.ppat.0010026</pubid>
                  <pubid idtype="pmcid">1287908</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Three multigene families in Plasmodium parasites: facts and questions</p>
            </title>
            <aug>
               <au>
                  <snm>Mercereau-Puijalon</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Barale</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Bischoff</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>Int J Parasitol. </source>
            <pubdate>2002</pubdate>
            <volume>32</volume>
            <issue>11</issue>
            <fpage>1323</fpage>
            <lpage>1344</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0020-7519(02)00111-X</pubid>
                  <pubid idtype="pmpid" link="fulltext">12350369</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Genomic distribution and functional characterisation of two distinct and conserved <it>Plasmodium falciparum </it>var gene 5' flanking sequences</p>
            </title>
            <aug>
               <au>
                  <snm>Voss</snm>
                  <fnm>TS</fnm>
               </au>
               <au>
                  <snm>Thompson</snm>
                  <fnm>JK</fnm>
               </au>
               <au>
                  <snm>Waterkeyn</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Felger</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Weiss</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Cowman</snm>
                  <fnm>AF</fnm>
               </au>
               <au>
                  <snm>Beck</snm>
                  <fnm>HP</fnm>
               </au>
            </aug>
            <source>Mol Biochem Parasitol</source>
            <pubdate>2000</pubdate>
            <volume>107</volume>
            <fpage>103</fpage>
            <lpage>115</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">10717306</pubid>
                  <pubid idtype="doi">10.1016/S0166-6851(00)00176-6</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Sub-grouping and sub-functionalization of the RIFIN multi-copy protein family</p>
            </title>
            <aug>
               <au>
                  <snm>Joannin</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Abhiman</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Sonnhammer</snm>
                  <fnm>EL</fnm>
               </au>
               <au>
                  <snm>Wahlgren</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>BMC Genomics</source>
            <pubdate>2008</pubdate>
            <volume>9</volume>
            <fpage>19</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">18197962</pubid>
                  <pubid idtype="doi">10.1186/1471-2164-9-19</pubid>
                  <pubid idtype="pmcid">2257938</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>Variant proteins of the <it>Plasmodium falciparum </it>RIFIN family show distinct subcellular localization and developmental expression patterns</p>
            </title>
            <aug>
               <au>
                  <snm>Petter</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Haeggstrom</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Khattab</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Fernandez</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Klinkert</snm>
                  <fnm>MQ</fnm>
               </au>
               <au>
                  <snm>Wahlgren</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Mol Biochem Parasitol</source>
            <pubdate>2007</pubdate>
            <volume>156</volume>
            <fpage>51</fpage>
            <lpage>61</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">17719658</pubid>
                  <pubid idtype="doi">10.1016/j.molbiopara.2007.07.011</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>A genome-wide map of diversity in <it>Plasmodium falciparum</it></p>
            </title>
            <aug>
               <au>
                  <snm>Volkman</snm>
                  <fnm>SK</fnm>
               </au>
               <au>
                  <snm>Sabeti</snm>
                  <fnm>PC</fnm>
               </au>
               <au>
                  <snm>DeCaprio</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Neafsey</snm>
                  <fnm>DE</fnm>
               </au>
               <au>
                  <snm>Schaffner</snm>
                  <fnm>SF</fnm>
               </au>
               <au>
                  <snm>Milner</snm>
                  <fnm>DA</fnm>
                  <suf>Jr</suf>
               </au>
               <au>
                  <snm>Daily</snm>
                  <fnm>JP</fnm>
               </au>
               <au>
                  <snm>Sarr</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Ndiaye</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Ndir</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Mboup</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Duraisingh</snm>
                  <fnm>MT</fnm>
               </au>
               <au>
                  <snm>Lukens</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Derr</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Stange-Thomann</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Waggoner</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Onofrio</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Ziaugra</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Mauceli</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Gnerre</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Jaffe</snm>
                  <fnm>DB</fnm>
               </au>
               <au>
                  <snm>Zainoun</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Wiegand</snm>
                  <fnm>RC</fnm>
               </au>
               <au>
                  <snm>Birren</snm>
                  <fnm>BW</fnm>
               </au>
               <au>
                  <snm>Hartl</snm>
                  <fnm>DL</fnm>
               </au>
               <au>
                  <snm>Galagan</snm>
                  <fnm>JE</fnm>
               </au>
               <au>
                  <snm>Lander</snm>
                  <fnm>ES</fnm>
               </au>
               <au>
                  <snm>Wirth</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Nat Genet</source>
            <pubdate>2007</pubdate>
            <volume>39</volume>
            <fpage>113</fpage>
            <lpage>119</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">17159979</pubid>
                  <pubid idtype="doi">10.1038/ng1930</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>Genome variation and evolution of the malaria parasite <it>Plasmodium falciparum</it></p>
            </title>
            <aug>
               <au>
                  <snm>Jeffares</snm>
                  <fnm>DC</fnm>
               </au>
               <au>
                  <snm>Pain</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Berry</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Cox</snm>
                  <fnm>AV</fnm>
               </au>
               <au>
                  <snm>Stalker</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Ingle</snm>
                  <fnm>CE</fnm>
               </au>
               <au>
                  <snm>Thomas</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Quail</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Siebenthall</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Uhlemann</snm>
                  <fnm>AC</fnm>
               </au>
               <au>
                  <snm>Kyes</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Krishna</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Newbold</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Dermitzakis</snm>
                  <fnm>ET</fnm>
               </au>
               <au>
                  <snm>Berriman</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Nat Genet</source>
            <pubdate>2007</pubdate>
            <volume>39</volume>
            <fpage>120</fpage>
            <lpage>125</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">17159978</pubid>
                  <pubid idtype="doi">10.1038/ng1931</pubid>
                  <pubid idtype="pmcid">2663918</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>Low-level <it>Plasmodium falciparum </it>transmission and the incidence of severe malaria infections on the Kenyan coast</p>
            </title>
            <aug>
               <au>
                  <snm>Mbogo</snm>
                  <fnm>CN</fnm>
               </au>
               <au>
                  <snm>Snow</snm>
                  <fnm>RW</fnm>
               </au>
               <au>
                  <snm>Kabiru</snm>
                  <fnm>EW</fnm>
               </au>
               <au>
                  <snm>Ouma</snm>
                  <fnm>JH</fnm>
               </au>
               <au>
                  <snm>Githure</snm>
                  <fnm>JI</fnm>
               </au>
               <au>
                  <snm>Marsh</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Beier</snm>
                  <fnm>JC</fnm>
               </au>
            </aug>
            <source>Am J Trop Med Hyg</source>
            <pubdate>1993</pubdate>
            <volume>49</volume>
            <fpage>245</fpage>
            <lpage>253</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">8357087</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>Human malaria parasites in continuous culture</p>
            </title>
            <aug>
               <au>
                  <snm>Trager</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Jensen</snm>
                  <fnm>JB</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>1976</pubdate>
            <volume>193</volume>
            <fpage>673</fpage>
            <lpage>675</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">781840</pubid>
                  <pubid idtype="doi">10.1126/science.781840</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>Extraction and purification of Plasmodium parasite DNA</p>
            </title>
            <aug>
               <au>
                  <snm>Beck</snm>
                  <fnm>HP</fnm>
               </au>
            </aug>
            <source>Methods Mol Med</source>
            <pubdate>2002</pubdate>
            <volume>72</volume>
            <fpage>159</fpage>
            <lpage>163</lpage>
            <xrefbib>
               <pubid idtype="pmpid">12125113</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B31">
            <title>
               <p>A simple RNA analysis method shows var and rif multigene family expression patterns in <it>Plasmodium falciparum</it></p>
            </title>
            <aug>
               <au>
                  <snm>Kyes</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Pinches</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Newbold</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Mol Biochem Parasitol</source>
            <pubdate>2000</pubdate>
            <volume>105</volume>
            <fpage>311</fpage>
            <lpage>315</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">10693754</pubid>
                  <pubid idtype="doi">10.1016/S0166-6851(99)00193-0</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B32">
            <title>
               <p>Small variant STEVOR antigen is uniquely located within Maurer's clefts in <it>Plasmodium falciparum</it>-infected red blood cells</p>
            </title>
            <aug>
               <au>
                  <snm>Kaviratne</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Khan</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Jarra</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Preiser</snm>
                  <fnm>PR</fnm>
               </au>
            </aug>
            <source>Eukaryot Cell</source>
            <pubdate>2002</pubdate>
            <volume>1</volume>
            <fpage>926</fpage>
            <lpage>935</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">12477793</pubid>
                  <pubid idtype="doi">10.1128/EC.1.6.926-935.2002</pubid>
                  <pubid idtype="pmcid">138759</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <aug>
               <au>
                  <snm>Plamsmo</snm>
                  <fnm>DB</fnm>
               </au>
            </aug>
            <url>http://www.plasmodb.org</url>
         </bibl>
         <bibl id="B34">
            <title>
               <p>CLUSTAL: a package for performing multiple sequence alignment on a microcomputer</p>
            </title>
            <aug>
               <au>
                  <snm>Higgins</snm>
                  <fnm>DG</fnm>
               </au>
               <au>
                  <snm>Sharp</snm>
                  <fnm>PM</fnm>
               </au>
            </aug>
            <source>Gene</source>
            <pubdate>1988</pubdate>
            <volume>73</volume>
            <fpage>237</fpage>
            <lpage>244</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">3243435</pubid>
                  <pubid idtype="doi">10.1016/0378-1119(88)90330-7</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B35">
            <title>
               <p>MEGA3: Integrated software for Molecular Evolutionary Genetics Analysis and sequence alignment</p>
            </title>
            <aug>
               <au>
                  <snm>Kumar</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Tamura</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Nei</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Brief Bioinform</source>
            <pubdate>2004</pubdate>
            <volume>5</volume>
            <fpage>150</fpage>
            <lpage>163</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">15260895</pubid>
                  <pubid idtype="doi">10.1093/bib/5.2.150</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B36">
            <title>
               <p>PAUP*: Phylogenetic Analysis Using Parsimony (and other methods) 4.0 Beta</p>
            </title>
            <aug>
               <au>
                  <snm>Swofford</snm>
                  <fnm>DL</fnm>
               </au>
            </aug>
            <publisher>Sunderland, MA: Sinauer Associates</publisher>
            <pubdate>2003</pubdate>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">18428704</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B37">
            <title>
               <p>TreeView: an application to display phylogenetic trees on personal computers</p>
            </title>
            <aug>
               <au>
                  <snm>Page</snm>
                  <fnm>RD</fnm>
               </au>
            </aug>
            <source>Comput Appl Biosci</source>
            <pubdate>1996</pubdate>
            <volume>12</volume>
            <fpage>357</fpage>
            <lpage>358</lpage>
            <xrefbib>
               <pubid idtype="pmpid">8902363</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B38">
            <title>
               <p>Phylogenies from molecular sequences: inference and reliability</p>
            </title>
            <aug>
               <au>
                  <snm>Felsenstein</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Annu Rev Genet</source>
            <pubdate>1988</pubdate>
            <volume>22</volume>
            <fpage>521</fpage>
            <lpage>565</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">3071258</pubid>
                  <pubid idtype="doi">10.1146/annurev.ge.22.120188.002513</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B39">
            <title>
               <p><it>Plasmodium falciparum </it>STEVOR proteins are highly expressed in patient isolates and located in the surface membranes of infected red blood cells and the apical tips of merozoites</p>
            </title>
            <aug>
               <au>
                  <snm>Blythe</snm>
                  <fnm>JE</fnm>
               </au>
               <au>
                  <snm>Yam</snm>
                  <fnm>XY</fnm>
               </au>
               <au>
                  <snm>Kuss</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Bozdech</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Holder</snm>
                  <fnm>AA</fnm>
               </au>
               <au>
                  <snm>Marsh</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Langhorne</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Preiser</snm>
                  <fnm>PR</fnm>
               </au>
            </aug>
            <source>Infect Immun</source>
            <pubdate>2008</pubdate>
            <volume>76</volume>
            <fpage>3329</fpage>
            <lpage>3336</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">18474651</pubid>
                  <pubid idtype="doi">10.1128/IAI.01460-07</pubid>
                  <pubid idtype="pmcid">2446718</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B40">
            <title>
               <p>Genetic analysis of the human malaria parasite <it>Plasmodium falciparum</it></p>
            </title>
            <aug>
               <au>
                  <snm>Walliker</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Quakyi</snm>
                  <fnm>IA</fnm>
               </au>
               <au>
                  <snm>Wellems</snm>
                  <fnm>TE</fnm>
               </au>
               <au>
                  <snm>McCutchan</snm>
                  <fnm>TF</fnm>
               </au>
               <au>
                  <snm>Szarfman</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>London</snm>
                  <fnm>WT</fnm>
               </au>
               <au>
                  <snm>Corcoran</snm>
                  <fnm>LM</fnm>
               </au>
               <au>
                  <snm>Burkot</snm>
                  <fnm>TR</fnm>
               </au>
               <au>
                  <snm>Carter</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>1987</pubdate>
            <volume>236</volume>
            <fpage>1661</fpage>
            <lpage>1666</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">3299700</pubid>
                  <pubid idtype="doi">10.1126/science.3299700</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B41">
            <title>
               <p>Comparative genomics of the neglected human malaria parasite <it>Plasmodium vivax</it></p>
            </title>
            <aug>
               <au>
                  <snm>Carlton</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Adams</snm>
                  <fnm>JH</fnm>
               </au>
               <au>
                  <snm>Silva</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Bidwell</snm>
                  <fnm>SL</fnm>
               </au>
               <au>
                  <snm>Lorenzi</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Caler</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Crabtree</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Angiuoli</snm>
                  <fnm>SV</fnm>
               </au>
               <au>
                  <snm>Merino</snm>
                  <fnm>EF</fnm>
               </au>
               <au>
                  <snm>Amedeo</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Cheng</snm>
                  <fnm>Q</fnm>
               </au>
               <au>
                  <snm>Coulson</snm>
                  <fnm>RM</fnm>
               </au>
               <au>
                  <snm>Crabb</snm>
                  <fnm>BS</fnm>
               </au>
               <au>
                  <snm>Del Portillo</snm>
                  <fnm>HA</fnm>
               </au>
               <au>
                  <snm>Essien</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Feldblyum</snm>
                  <fnm>TV</fnm>
               </au>
               <au>
                  <snm>Fernandez-Becerra</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Gilson</snm>
                  <fnm>PR</fnm>
               </au>
               <au>
                  <snm>Gueye</snm>
                  <fnm>AH</fnm>
               </au>
               <au>
                  <snm>Guo</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Kang'a</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Kooij</snm>
                  <fnm>TW</fnm>
               </au>
               <au>
                  <snm>Korsinczky</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Meyer</snm>
                  <fnm>EV</fnm>
               </au>
               <au>
                  <snm>Nene</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Paulsen</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>White</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Ralph</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Ren</snm>
                  <fnm>Q</fnm>
               </au>
               <au>
                  <snm>Sargeant</snm>
                  <fnm>TJ</fnm>
               </au>
               <au>
                  <snm>Salzberg</snm>
                  <fnm>SL</fnm>
               </au>
               <au>
                  <snm>Stoeckert</snm>
                  <fnm>CJ</fnm>
               </au>
               <au>
                  <snm>Sullivan</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Yamamoto</snm>
                  <fnm>MM</fnm>
               </au>
               <au>
                  <snm>Hoffman</snm>
                  <fnm>SL</fnm>
               </au>
               <au>
                  <snm>Wortman</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Gardner</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Galinski</snm>
                  <fnm>MR</fnm>
               </au>
               <au>
                  <snm>Barnwell</snm>
                  <fnm>JW</fnm>
               </au>
               <au>
                  <snm>Fraser-Liggett</snm>
                  <fnm>CM</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>2008</pubdate>
            <volume>455</volume>
            <fpage>757</fpage>
            <lpage>763</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">18843361</pubid>
                  <pubid idtype="doi">10.1038/nature07327</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B42">
            <title>
               <p>Rapid changes in transcription profiles of the <it>Plasmodium yoelii </it>yir multigene family in clonal populations: lack of epigenetic memory?</p>
            </title>
            <aug>
               <au>
                  <snm>Cunningham</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Fonager</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Jarra</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Carret</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Preiser</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Langhorne</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>PLoS ONE</source>
            <pubdate>2009</pubdate>
            <volume>4</volume>
            <fpage>e4285</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">19173007</pubid>
                  <pubid idtype="doi">10.1371/journal.pone.0004285</pubid>
                  <pubid idtype="pmcid">2628738</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B43">
            <title>
               <p>Host switch leads to emergence of <it>Plasmodium vivax </it>malaria in humans</p>
            </title>
            <aug>
               <au>
                  <snm>Mu</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Joy</snm>
                  <fnm>DA</fnm>
               </au>
               <au>
                  <snm>Duan</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Huang</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Carlton</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Walker</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Barnwell</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Beerli</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Charleston</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Pybus</snm>
                  <fnm>OG</fnm>
               </au>
               <au>
                  <snm>Su</snm>
                  <fnm>XZ</fnm>
               </au>
            </aug>
            <source>Mol Biol Evol</source>
            <pubdate>2005</pubdate>
            <volume>22</volume>
            <fpage>1686</fpage>
            <lpage>1693</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">15858201</pubid>
                  <pubid idtype="doi">10.1093/molbev/msi160</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B44">
            <title>
               <p>Global genetic diversity and evolution of var genes associated with placental and severe childhood malaria</p>
            </title>
            <aug>
               <au>
                  <snm>Trimnell</snm>
                  <fnm>AR</fnm>
               </au>
               <au>
                  <snm>Kraemer</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Mukherjee</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Phippard</snm>
                  <fnm>DJ</fnm>
               </au>
               <au>
                  <snm>Janes</snm>
                  <fnm>JH</fnm>
               </au>
               <au>
                  <snm>Flamoe</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Su</snm>
                  <fnm>XZ</fnm>
               </au>
               <au>
                  <snm>Awadalla</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Smith</snm>
                  <fnm>JD</fnm>
               </au>
            </aug>
            <source>Mol Biochem Parasitol</source>
            <pubdate>2006</pubdate>
            <volume>148</volume>
            <fpage>169</fpage>
            <lpage>180</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">16697476</pubid>
                  <pubid idtype="doi">10.1016/j.molbiopara.2006.03.012</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B45">
            <title>
               <p>In vivo transcriptome of <it>Plasmodium falciparum </it>reveals overexpression of transcripts that encode surface proteins</p>
            </title>
            <aug>
               <au>
                  <snm>Daily</snm>
                  <fnm>JP</fnm>
               </au>
               <au>
                  <snm>Le Roch</snm>
                  <fnm>KG</fnm>
               </au>
               <au>
                  <snm>Sarr</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Ndiaye</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Lukens</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Zhou</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Ndir</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Mboup</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Sultan</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Winzeler</snm>
                  <fnm>EA</fnm>
               </au>
               <au>
                  <snm>Wirth</snm>
                  <fnm>DF</fnm>
               </au>
            </aug>
            <source>J Infect Dis</source>
            <pubdate>2005</pubdate>
            <volume>191</volume>
            <fpage>1196</fpage>
            <lpage>1203</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">15747257</pubid>
                  <pubid idtype="doi">10.1086/428289</pubid>
                  <pubid idtype="pmcid">2582152</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B46">
            <title>
               <p>Diverse expression patterns of subgroups of the rif multigene family during <it>Plasmodium falciparum </it>gametocytogenesis</p>
            </title>
            <aug>
               <au>
                  <snm>Petter</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Bonow</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Klinkert</snm>
                  <fnm>MQ</fnm>
               </au>
            </aug>
            <source>PLoS ONE</source>
            <pubdate>2008</pubdate>
            <volume>3</volume>
            <fpage>e3779</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">19020666</pubid>
                  <pubid idtype="doi">10.1371/journal.pone.0003779</pubid>
                  <pubid idtype="pmcid">2582490</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
      </refgrp>
   </bm>
</art>

