The P. falciparum CS2KO clone 17 and CS2 wild type were cultured as previously described in RPMI-HEPES supplemented with NaHCO3, gentamicin, and 0.5% Albumax II (Gibco) 21. Parasite line E8B was cultured the same medium, but supplemented with 5% serum and 0.25% Albumax II. To sustain the expression of knobby parasites, trophozoite-stage IE underwent weekly flotation in 0.75% gelatin in RPMI-HEPES 22. Parasites were maintained in malaria gas mix (5% CO₂, 1% O₂ in N₂).

The human choriocarcinoma-derived cell line BeWo was a gift from Robin Mortimer (Placental Transport Unit, QIMR, Australia). BeWo cells were cultured in RPMI 1640 (Invitrogen)-L-glutamine, supplemented with 10% fetal bovine serum (Invitrogen), and 1% penicillin and streptomycin solution. The cells were grown in a humidified atmosphere in 5% CO₂.

To select CS2KO IE on BeWo cells, trophozoite-stage IE were purified by flotation in 0.5% or 0.75% gelatin in RPMI-HEPES, to 70–80% parasitaemia. The assays were carried out in cytoadherence medium (RPMI-HEPES pH6.8, supplemented with 10% human serum). BeWo cells were grown to ~80% confluence in a tissue culture-treated dish (Falcon, 150 × 22 mm) for up to 48 hr prior the adhesion assays. The cells were washed once with cytoadherence medium before selection. Purified IE were resuspended, and co-incubated on BeWo cells for 45 minutes at 37°C in the malaria gas mixture. Unbound cells were gently washed off with RPMI-HEPES, and bound IE detached by aspiration with parasite culture medium directly onto BeWo cells. Detached IE were then returned to culture with fresh erythrocytes. After each round of selection, IE were grown to ~6–8% parasitaemia, and binding levels were evaluated before reselection. This cycle was repeated ten times on BeWo cells.

To evaluate adhesion, IE at 1% haematocrit and 6–8% parasitaemia in cytoadherence medium were added to triplicate wells of BeWo cells (~80% confluent) cultured in 6-well plates, with or without 10 μg/ml of bovine trachea CSA (Sigma). After 45 min of co-incubation in malaria gas mix at 37°C, unbound cells were removed by gentle washing with RPMI-HEPES, pH6.8. Bound IE were fixed using 2% glutaraldehyde and stained with Giemsa (Merck). The mean (± SEM) number of adherent IE per 100 BeWo cell nuclei was determined in two independent experiments, by counting under oil immersion (100 × magnification).

To examine the effect of an ICAM-1 blocking antibody (15.2, Serotec) on IE adhesion to BeWo, 8–10 mm diameter wells were created in 6 well plates using a wax pen (Dako) prior to plating. When BeWo cells reached 70–80% confluency they were then co-cultured with IE at 6–8% parasitaemia in cytoadherence medium, with or without anti-ICAM-1 antibody at 10 μg/ml, and experiments performed as described above.

Adhesion to purified receptors was carried out as previously described 2123. Purified receptors used were bovine trachea CSA (Sigma), CD36 (R&D Systems), ICAM-1 (Bendermed Systems), human chondroitin sulphate proteoglycan (purified from placental blood; Malaria Research and Reference Reagent Resource Center), HA (from bovine vitreous humour; Sigma) and Fibrinogen (from human plasma; Calbiochem). These receptors were immobilized on plastic Petri dishes (150 mm-diameter, Falcon 1058) as previously described, with some minor adjustments 21. Briefly, three spots containing selected receptors were blocked with casein (Pierce Biotechnology, Rockford IL) for 30 min at RT, and then washed twice with PBS before adding IE diluted in cytoadherence medium (6–8% parasitaemia and 2% haematocrit). Cultures were incubated at 37°C in a moist box for 45 min, then unbound erythrocytes were removed by gentle washing with RPMI-HEPES. After fixing in 2% glutaraldehyde and staining with Giemsa, the number of adherent IE/mm² was determined in two to three independent experiments, by counting under oil immersion (100 × magnification).

Adhesion assays on ex vivo placental tissue were performed as described previously 24. Briefly, gelatin-purified trophozoite-stage IEs, that had been grown in RPMI 1640 containing 0.5% Albumax II, were resuspended at 5 × 10⁶ IE/ml in cytoadherence medium. IE were incubated at room temperature on unfixed sets of three consecutive 5-μm cryosections of normal human placenta. Adhesion was carried out for 1 h, with agitation every 20 min, followed by gentle washing in RPMI 1640 (pH 6.8) to remove unbound IE. CS-specific adhesion was determined by pre-incubating placental tissue with 0.5 units/ml chondroitinase ABC (cABC; Fluka) for 30 min at 37°C, washing three times in RPMI 1640 (pH 6.8), and then adding IE. Specific adhesion to CSA was tested by pre-incubating IE with 100 μg/ml CSA for 15 minutes prior to incubating on placental tissue. Adhesion to CD36 or ICAM-1 was tested by pre-incubating placental sections with 0.5 μg/ml anti-CD36 antibody (FA6/152; Beckman Coulter) or 10 μg/ml anti-ICAM-1 antibody. Following adhesion assays, sections were fixed in 2% glutaraldehyde, stained with Giemsa, and the average number of IE (± SEM) per field (10 fields per well) was determined using a 40 × objective. IE adhesion within the intervillous space, directly to syncytiotrophoblast, or within the foetal villous tissue was determined for at least three independent cryosections (sourced from two different placentas). In each case, binding of IE was compared to IE adhesion on an untreated control section present on the same slide. Placental tissue was obtained with approval from the Mater Human Research Ethics Committee, Brisbane, Australia, after informed written consent.

Serum and plasma samples were collected from pregnant women and men who lived in Blantyre, Malawi or Madang, Papua New Guinea, with informed consent from donors. Three sets of samples were tested. Cohort-one comprised sera collected in late third trimester of pregnancy from HIV uninfected, malaria infected pregnant women from Queen Elizabeth Central Hospital, Blantyre, collected in 2002–4 25. Samples from male patients were from fathers of children admitted to the same hospital with severe malaria 21. Cohort-two comprised unselected pregnant women and men attending outpatient clinics at Modilon Hospital, Madang, collected in 2001–2 26. Cohort-three comprised plasma from pregnant women collected at delivery in Blantyre, Malawi, and samples again from fathers of children admitted to the same hospital with severe malaria, collected in 1997–9 27. Negative control sera were collected from Australian blood donors. The collection and use of these samples were approved by the College of Medicine Research Committee, University of Malawi, the Papua New Guinea Medical Research Advisory Committee, and the Clinical Research Ethics Committee, Royal Melbourne Hospital Research Foundation, Victoria, Australia.

Flow cytometry to measure antibodies against VSA expressed by IE was carried out according to our previously described method 27. Trophozoite stage IE (6–8% parasitaemia, 0.1% haematocrit) were incubated with serum at 1/20 dilution, washed, then incubated with rabbit anti-human IgG (DAKO) and Alexa Fluor 488-conjugated anti-rabbit IgG. Parasite nucleic acid was stained with ethidium bromide (10 μg/ml). Samples were washed three times after each step, and assayed using a BD FACScalibur flow cytometer. The level of specific IgG staining was calculated by subtracting the mean fluorescence intensity (MFI) of uninfected erythrocytes from the MFI of the IE 17. Non-parametric one way ANOVA statistical analysis was used.

RNA from synchronized ring stage IE ~4–8 hr post invasion was extracted using Trizol reagent (Invitrogen). 28. Contaminating DNA was removed by treatment with Turbo DNase (Ambion). cDNA synthesis was performed using Superscript III reverse transcriptase (Invitrogen). PCR was performed to amplify cDNAs using previously-published degenerate nucleotides derived from conserved sequences within var gene DBL α 29 and DBL β 30 domains. Primers used were DBLα forward GGinosineGCinosineTG(C/T)GCinosineCC(A/G)T(A/T)(C/T)(A/C)G; DBLα reverse TCTTCinosineG(C/T)CCATTCCTCGAACCA; DBLβ forward (DBL_5.3) G(T/A)(C/G)AACA(T/C)(A/T)T(G/T)TGTAC(A/C)TC; DBLβ reverse (DBL_3.2) AATC(G/T)TTG(A/G/T)GG(A/G)AT(A/G)TA(A/G)TC. PCR products were cloned and 20 clones of each product were sequenced.

Absolute quantitation of the cDNAs of the two var genes identified by cloning was performed by Q-RT-PCR using standard curves of plasmids containing var gene sequences as previously described 13. Quantitation of 18S rRNA was used to normalize parasite cDNAs and employed the primers GCTGACTACGTCCCTGCCC and ACAATTCATCATATCTTTCAATCGGTA and standard curves of diluted parasite gDNA. The primers used for Q-RT-PCR of the cloned var genes were IT4var44 (forward TGCTTCATATTTTCGACCAACGT and reverse CAGCGGCATCGGTTTTG) at 6 μM and IT4var19 (forward TGATAAATCTGCAATTTGTAATGCTATG and reverse CCAAGGTCGGCGAAACTATATT) at 2 μM concentrations. In addition, var2CSA-specific primers were used as described (forward GGATTGACCACACCGTCTTCTT and reverse TGTCCGCGCCACATATGT) at 2 μM. DNAse-treated RNA of CS2KO9 was used as a negative control for all quantitative RT-PCR runs. cDNAs were normalized against quantitation of 18S RNA.

Northern blots, performed as described previously 13, were hybridized at 55°C with radiolabelled probes derived from IT4var19 DBLβ and var exon2 sequences. The blots were washed twice at 55°C with 2 × SSC 0.1% SDS (exon 2) or at 60°C with 0.5 × SSC 0.1% SDS prior to exposure to film. Probed blots were stripped with boiling 0.5% SDS and absence of signal confirmed by exposure to film prior to re-probing.

CS2 IE bound at high levels to BeWo cells ((343 ± 54 (SEM) IE/100 BeWo) and, as expected 31, binding was inhibited by more than 70% by free CSA (85 ± 36 IE/100 BeWo). By contrast, IE of the var2csa knockout CS2 (CS2KO) bound at low levels to BeWo cells (Figure 1), even after five rounds of panning selection. After repeated cycles of selection on BeWo, adhesion of CS2KO increased; after seven cycles adhesion reached a plateau at 120–150 IE per 100 BeWo nuclei (Figure 1). Adhesion was not CSA-dependent, and was around half that of CS2 adhesion to BeWo (145 ± 9; 159 ± 14/100 BeWo nuclei for the selected CS2KO in absence and presence of CSA, respectively). For subsequent characterization CS2KO selection 9 IE (termed CS2KO9) were used.

The adhesion of CS2 and CS2KO9 IE to purified receptors immobilized on plastic was determined. The adhesion profile of CS2 IE was similar to that previously published (Figure 2a) 71732, whereas CS2KO9 IE adhered to ICAM-1, and to a lesser extent to CD36, with minimal binding to CSA, and none to CSPGs (Figure 2b). Thus, disruption of var2csa changes the adhesion profile away from the major placental malaria receptor (CSA), and selection on BeWo does not restore this profile.

To determine whether CS2KO9 IE which adhered to immobilized ICAM-1 also adhered to ICAM-1 on BeWo cells or placental sections, a blocking antibody to ICAM-1 was used. ICAM-1 did not appear to be a major mediator of adhesion to BeWo (CS2KO9, 124.1 (+/- 59.5) IE per 100 BeWo nuclei; CS2KO9 + 10 μg/ml anti-ICAM-1, 125.1 (+/- 47.2) IE per 100 BeWo nuclei). Moreover, the parasite line E8B (which adheres at high levels to soluble ICAM-1) bound to BeWo at low levels (31.0 (+/- 4.0) IE per 100 BeWo nuclei).

To evaluate whether CS2KO9 might represent a parasite type able to sequester in the placenta in a CSA-independent manner, adhesion of CS2 and CS2KO9 to ex vivo placental tissue sections was investigated 33. CS2 IE bound to both the intervillous space and the placental syncytiotrophoblast and this binding was inhibited by free CSA and chondroitinase ABC treatment of tissue, consistent with the known distribution of CSA in placenta 8 (Figure 3a). CS2KO9 bound at low levels to both IVS and SCT, and this binding was not inhibited by CSA or chondroitinase ABC (Figure 3a). Adhesion to accessible sites was about 30% of that for CS2 IE, however binding of CS2KO9 IE was predominantly to fetal villous tissue, which is not accessible to IE in vivo. This binding may be mediated by CD36, which is known to be expressed in fetal villous tissue 34, as it was significantly inhibited by a blocking antibody to CD36 (Figure 3b). Anti-ICAM-1 did not affect binding of CS2KO9 to placenta (Figure 3c), however binding of a control ICAM-1 binding IE line (E8B), which adheres to the villi and at low levels on the syncytiotrophoblast, was inhibited by anti-ICAM-1 blocking antibody, but not free CSA (Figure 3c).

Variant surface antigens (VSA) of placental and CSA adherent IE are recognized by sera and plasma from pregnant women in a gender and gravidity-dependent manner. The ability of sera or plasma to recognize CS2 and CS2KO9 IE was assessed, using two cohorts from Malawi and one from Papua New Guinea. For CS2 IE, each cohort showed gender and parity-dependent recognition, although not all differences were statistically significant (Figure 4a,d and 4f). Cohort-one (Figure 4a) showed marked gender and parity dependent recognition of CS2, cohort-three showed significant gender-dependent changes, and cohort-two showed similar trends. A similar, but less pronounced, pattern was seen for CS2KO9 with the first Malawi cohort tested (Figure 4b), but not for E8B which adheres to ICAM-1 and CD36 receptors, but not CSA (Figure 4c), prompting us to test other cohorts. Neither of these showed significant differences by gender or parity in recognition of CS2KO9 (Figure 4e and 4g). We conclude that gender and parity dependent recognition of CS2KO9 occurs uncommonly, and that VSA of CS2KO9 are not prominent targets of pregnancy-specific immunity. The pattern of recognition seen is in keeping with that for other CD36 or ICAM-1 adherent isolates 21.

Var genes encode PfEMP-1 members, which mediate adhesion to host receptors such as CSA, ICAM-1 and CD36. To investigate whether selection on BeWo cells had resulted in selection for expression of a particular var gene, or group of var genes, we analysed RNA from CS2KO unselected and CS2KO9 BeWo selected parasites by Northern blot (Fig 5a). A conserved var exon 2 probe that hybridizes to most var transcripts hybridized to a larger transcript(s) in CS2KO9 than in CS2KO indicating that this larger transcript(s) encoded the BeWo adhesion phenotype. To determine which var gene(s) are expressed by CS2KO9, we used RT-PCR amplification of DBLα and DBLβ var gene domains to identify transcripts of two var genes, It4_var19 (accession EF158075) and It4_var44 (accession EF158091) (Figure 5) in CS2KO9 parasites. We then used Q-RT-PCR to quantitate levels of transcription of It4_var19, It4_var44 and var2csa in unselected CS2KO, and CS2KO9. Transcripts of var19 were much more abundant in CS2KO9 than CS2KO unselected parasites. The dominance of It4_var19 in CS2KO9 was confirmed by its co-migration with the most abundant var transcripts in CS2KO9, identified by hybridization with the conserved exon 2 probe (Figure 5a). These data indicated that expression of It4_var19 contributed to the CS2KO9 phenotype of adhesion to BeWo. Transcripts of It4_var44 were only marginally more abundant in CS2KO9 than in CS2KO unselected parasites, indicating that expression of It4_var44 was not important for the BeWo adhesion phenotype and, as expected, neither isolate transcribed var2csa.