Parasites 3D7AH1, 3D7S8, FCR3, FCR3S1.2, 7G8 and TM180 were maintained in continuous culture according to standard procedures 2223.

Based on the 3D7 sequences of the annotated SURFINs, two sets of forward and reverse primers (Primer set 1 and Primer set 2), were designed for each surf gene. Some of the primers were designed to cross introns while others were within the open reading frames (ORFs) (Additional Files 1 and 2). Genomic DNA was extracted from trophozoite stages of 3D7S8, NF54, 7G8, DD2, FCR3, FCR3S1.2, TM284, TM180, R29, UAM25, UKS03, and UKS05 using the DNeasy Blood and Tissue kit according to the manufacturer's instructions (Qiagen, USA). Using two sets of independently designed surf gene specific primers, DNA was PCR amplified from each parasite. The following were the PCR conditions 35 cycles of 94°C for 30 sec, 55°C for 30 sec, and 68°C 60 sec.

Highly synchronized 3D7S8 and FCR3 parasites were harvested post invasion (p.i.) at early ring (10 h), late ring (20 h), early trophozoite (30 h), and schizont (40 h) parasite stages. The parasites were resuspended in pre-warmed TRIzol (Invitrogen, USA) (37°C) and incubated at 37°C for 5 minutes. Total RNA was extracted using the manufacturer's instructions (Invitrogen, USA) and DNAse treated (Ambion, USA). The RNA (100 ng) was reverse transcribed (RT+) using MuLV reverse transcriptase enzyme and random hexamers (Applied Biosystems, USA) according to manufacturer's instructions. For each RT+ experiment, one RT- reaction (with reverse transcriptase omitted) was performed to ensure that there was no DNA contamination in the RNA.

surf_4.1 is currently present as PFD0100c in GeneDB, and PlasmboDB v5.4 but it was previously indicated as a truncated gene in the PlasmoDB v4.3 malaria database and was then suggestively comprised two distinct genes PFD0105c and PFD0100c. Primers (surfC_4.1F/R and Sintra_4.1 F/R) were consequently designed on opposite sides of the intergenic region of the two previously annotated genes (yielding amplification products of 1160 bp and 450 bp respectively, see Additional File 2). cDNA from ring stages, trophozoite stages and schizont stages was amplified using surfC_4.1F and surfC_4.1R. The RT-PCR cycling conditions were as follows: 35 cycles of 94°C for 30 sec, 55°C for 30 sec, and 68°C 60 sec. The cDNA from the different parasite stages was also amplified using primers specific to the surf_4.1 gene sections, these included 5CS-1F/R, 5CS-2F/R, surfC_4.1F/R, S_4.1F/R, 1C-S1F/R, 1C-S2F/R and 1C-S3F/R (Additional File 2).

PCR was conducted using primers surfC_4.1F/R (Additional File 2) that were designed to cross the intergenic region and at the same time also read through the intron of the first part of the surf_4.1 gene (PFD0105c). The primers were used to amplify cDNA and gDNA from FCR3S1.2, 3D7S8, and NF54. The cDNA and gDNA PCR products were cloned into TOPOII vector (Invitrogen USA) and prepared for sequencing using the BigDye v3.1 kit (Applied Biosystems, USA) according to manufacturer's instructions.

A fragment of surf_4.1, surf_4.1-C2 was PCR amplified using GWS_4.1F2, 5'- atcgagctcGTACTGAACCAAAACATCAT-3' and GWS_4.1R2, 5'-gatctcgagTGAATTAACGCTTCTTCTAGT-3' primers from parasite DNA and cloned into TOPOII vector. After sequence confirmation, labelling was performed using vector specific M13Reverse, GWSF2 and T6/T7 DIG labelling kit (Roche, Germany) according to manufacturer's instructions. Total RNA from early rings (10 h), late rings (20 h) early trophozoite (30 h), and schizonts (40 h) were subjected to agarose gel electrophoresis and transferred to a nitrocellulose membrane (0.45 μm) (BIORAD, USA). The subsequent methodology was performed as described previously 20.

A fragment of surf _4.1 (from the non-cytoplasmic part of the protein), SURFIN_4.1-C1 was PCR amplified from 3D7S8 using primers 5'-atcgagctcTTGGATAATACAGGTGAT-3' and 5'-gatctcgagTTCCTTATGATGTTTTGGT-3'. The amplified DNA was cloned into TOPOII vector and sequenced. The SURFIN_4.1-C1 fragment was subsequently cloned into the PQE Trisystem -His strep 2 expression vector (Qiagen, USA) which adds a stretch of 6 histidine residues to the C terminus and 8 streptavidin residues at the N-terminus. The fusion protein was purified on His-Trap columns (Amersham Biotec, Sweden) charged with Nickel ions (1 M, NiCl₂, SIGMA, USA) according to manufacturer's instructions. The purified fusion protein was used to immunize rabbits (500 μg/injection) and rats (100 μg/injection) in Freund's complete adjuvant (SIGMA, USA) and boosted three times at one-month intervals with the same protein concentration in Freund's incomplete adjuvant. The animals were bled 10 days after the last boost.

Late stage FCR3 and 3D7S8 pRBCs from ≈32 h onwards were lysed in SDS sample buffer. Extracts (5 × 10⁷ cells/lane) were separated on a 4–15% gradient SDS- PAGE (BIORAD). Proteins were transferred onto nitrocellulose membranes (0.45 μm) (BIORAD) and transiently stained with 0.1% Ponceau S in acetic acid. The membranes were blocked with 5% milk-PBS-0.05%Tween20 overnight (O/N) at 4°C, and then incubated with rabbit-anti- SURFIN_4.1-C1 purified IgG, polyclonal antibodies (1: 200) in blocking buffer O/N at 4°C. Goat-anti-rabbit Ig coupled to alkaline phosphatase (1:10,000, Amersham Biotech, Sweden) was used as secondary antibody and the protein was visualized using 5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium (BCIP/NBT) (SIGMA) in water.

Copy numbers of surf_4.1 were determined for 7G8, 3D7AH1, FCR3 and their daughter clones 3D7S8 and FCR3S1.2. Genomic DNA (gDNA) was prepared using Easy-DNA™ Kit (Invitrogen) as previously described 17. In addition, transcriptional levels were analysed for 3D7S8 and FCR3. Parasites were kept tightly synchronized using 5 % (w/v) sorbitol, and were harvested at 4 h post invasion intervals for two consecutive parasite generations. RNA from each time point was isolated using the RNeasy^® Mini Kit according to the manufacturer's instructions and contaminating gDNA was removed using the RNase-Free DNase Set (Qiagen). Total RNA was reversely transcribed with SuperScript III RNase H reverse transcriptase (Invitrogen), with random hexamers and oligo(dT)_12–18 (300 ng/ml and 25 ng/ml respectively; Invitrogen) at 50°C for two hours. For each cDNA synthesis reaction, a control reaction without reverse transcriptase (RT-) was performed with identical amounts of template. For real-time quantitative PCR (Rt-QPCR) determination of copy numbers as well as to monitor relative transcription of surf_4.1 to the endogenous control seryl-tRNA synthetase, the primers surf_4.1 were employed:

5'-TTTGAAGCTCCTGGTCAAGGA-3', surf_4.1-3': TTGTTTGTGCAAGTGTTTTGAAAG, PF07_0073-5': TATCATCTCAACAGGTAT CTACATCTCCTA and PF07_0073-3': TTTGAGAGTTACATGTGGTATCATCTTTT. These primers as well as the complete Rt-QPCR amplified product were designed to conserved regions in the parasite lines studied. Amplification efficiencies of the primer pairs were tested on dilution series of both gDNA and cDNA from all parasites, and were proven sufficiently close (ranging from 94.4 to 99.2%) to obviate the need for a correction factor. Amplification reactions for both relative copy numbers (gDNA) and relative transcription (cDNA) were done in quadruplicate in 20 μl, containing Power SYBR Green master mix (Applied Biosystems), 300 nM of each forward and reverse primer and 2 ng of template. Forty five cycles (95°C for 15 sec and 60°C for 1 min) were performed in an ABI sequence detector 7500 (Applied Biosystems). Relative copy numbers were analysed according to the ΔΔCt method and plotted using SigmaPlot 9.0 (Systat Software Inc.). Transcription levels were achieved by dividing log-transformed Ct values (2-x¯ Ctsurf4.1/2-x¯ Ctseryl-tRNA synthetase MathType@MTEF@5@5@+=feaafiart1ev1aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacPC6xNi=xH8viVGI8Gi=hEeeu0xXdbba9frFj0xb9qqpG0dXdb9aspeI8k8fiI+fsY=rqGqVepae9pg0db9vqaiVgFr0xfr=xfr=xc9adbaqaaeGaciGaaiaabeqaaeqabiWaaaGcbaGaeGOmaiZaaWbaaSqabeaacqqGTaqlcuWG4baEgaqeaiabbccaGiabboeadjabbsha0jabdohaZjabdwha1jabdkhaYjabdAgaMjabisda0iabc6caUiabigdaXaaakiabc+caViabikdaYmaaCaaaleqabaGaeeyla0IafmiEaGNbaebacqqGGaaicqqGdbWqcqqG0baDcqWGZbWCcqWGLbqzcqWGYbGCcqWG5bqEcqWGSbaBcqqGTaqlcqWG0baDcqWGsbGucqWGobGtcqWGbbqqcqqGGaaicqWGZbWCcqWG5bqEcqWGUbGBcqWG0baDcqWGObaAcqWGLbqzcqWG0baDcqWGHbqycqWGZbWCcqWGLbqzaaaaaa@5E46@) for each strain and time point (for details see Additional File 6). The standard deviation of the quotient was calculated according to the User Bulletin 2, Applied Biosystems. Results were visualized as log₂ transformed values plotted using SigmaPlot 9.0 (Systat Software Inc.).

For immunofluorescence assays (IFA), monolayers of pRBCs were prepared as previously described 24. Monolayers were incubated with rabbit anti-SURFIN_4.1-C1 antibody (1:400) or pre-immune serum for 30 min at room temperature and subsequently with a secondary anti-rabbit Alexa 488 (1:100; Jackson, USA) for 30 min. The cells were then incubated with propidium iodide (1:100) for nuclear staining for 30 min. Preparations were washed three times with PBS between each antibody preparation.

In the co-localization assay with EBA175, monolayers were incubated with rabbit anti-SURFIN_4.1-C1(1:100) for 30 min and thereafter with anti-rabbit -TRITC (1:100, Jackson, USA) for another 30 min. Monolayers were then probed with rat anti-EBA175 (MR-2) (1:400; ATCC/MR4) and after three washes with PBS probed with secondary anti-rat Alexa 488 antibody.

When SURFIN_4.1 was evaluated for its co-localization with SURFIN_4.2 and MSP1, monolayers were probed with rat anti-SURFIN_4.1-C1 (1:100) for 30 min, washed three times and incubated with secondary chicken-anti-rat Alexa 488 for 30 min. The monolayers were then incubated with rabbit anti-SURFIN_4.2 (1:200) or rabbit anti-MSP1 FVO (1:400, ATCC/MR4) for 30 min and then probed with secondary goat-anti-rabbit Ig- TRITC (1:100; Jackson, USA) for 30 min. HOESCHT and/or DAPI (Jackson, USA) were used for nuclear staining. All incubations were carried out at room temperature in a humid chamber. Slides were analysed with a Nikon Optiphot 2 UV microscope.

To analyse the ability of the immune anti-SURFIN_4.1-C1serum to agglutinate pRBCs, synchronized parasite cultures of 3D7S8 and FCR3 were incubated with serum as described by Barragan et al 25. The samples were then analysed under the microscope for presence of clumps or agglutinates. Acridine orange was used for staining of the parasite.

The presence of surf_4.1 in laboratory strains and clinical isolates was investigated. PCR on gDNA with surf_4.1 specific primers resulted in specific amplification in all parasite lines (Additional File 3). The remaining surf genes were also amplified, some with only one primer set while others were amplified using two primer sets. These two separate primer sets were used to account for any sequence differences and to ensure that as many surf genes were amplified from the different parasites. Genomic DNA sequences from 3D7, HB3, D10, DD2 and 7G8 from surf4.1 (1–2320 bp.) showed sequence polymorphisms within the parasite isolates (Additional File 4).

Six copies of surf_4.1 gene were observed in FCR3 and its daughter clone FCR3S1.2 and one copy in each of 3D7AH1, 3D7S8, and 7G8 (Figure 2A and Additional File 5). Achieved copy numbers confirm previous findings where microarray and fluorescent in situ hybridizations were used for quantification 18.

To understand the transcription patterns of the surf genes in the 3D7S8 parasite clone, RT-PCR was performed with primers specifically targeting individual sequences of all 10 surf genes (Additional File 1). Different surf genes were found expressed at different times during the erythrocytic cycle (Table 1). surf_1.3, surf_4.2 and surf_8.3 were expressed throughout the cycle, from the early rings to the schizonts, while other surf genes were either not detected (surf_1.2, surf_8.1, surf _8.2 and surf_13.1) or restricted to later trophozoites and/or schizont development (surf_1.1, surf_4.1 and surf_14.1) (Table 1). surf_4.1 was found prominently transcribed in late stages in the two parasite lines 3D7S8 and FCR3, with an apparent onset of transcription at ≈32 h and peaking in late schizonts (Figure 2B and Additional File 6). An obvious difference in transcript levels was observed between these two parasite lines, corresponding to the difference in copy numbers of the surf_4.1 gene.

The transcription pattern of surf_4.1 was confirmed with Northern blot experiments using specific probes. surf_4.1 mRNA of approximately 9 kB was detected in schizonts > 40 h post infection (Figure 1C).

Immunoblot analysis was performed with SDS-lysates obtained from synchronized in vitro cultures of 3D7S8 and FCR3. Using polyclonal rabbit-anti-SURFIN_4.1-C1 antibodies, a band of approximately 250 kDa was detected in schizont stage parasites (36–40 h), which corresponds to the predicted SURFIN_4.1 protein mass of 258 kDa (Figure 1D). Similar intensities were observed in both FCR3 and 3D7S8. Achieved data is consistent with the RT-PCR analysis suggesting PFD0100c and PFD0105c to form a single open reading frame.

To study the localization of SURFIN_4.1, IFA was carried out on 3D7S8 and FCR3 air-dried monolayers using purified rabbit-anti-SURFIN_4.1-C1 IgG. SURFIN_4.1 was found expressed during the mature stages of the parasite (30 h and onwards, Figure 3). There was no recognition of SURFIN_4.1 during the early ring stages (0–16 h) or in trophozoite stages (16–24 h). In the late trophozoite stages (25–30 h) SURFIN_4.1 was observed close to the food vacuole (FV) in the PV as a distinct spot, which later spread out within the PV in a dotty pattern (Figure 4) in both 3D7S8 and FCR3.

During late schizont stage, SURFIN_4.1 was seen as merozoite associated material (MAM) around the newly formed merozoites in intact schizonts. After schizont rupture SURFIN_4.1 localized around each individual merozoite (Figure 3). When a SURFIN_4.2 antibody was used on the same parasite stages, the same pattern of staining was achieved for both trophozoite and early schizont stages. However in the ruptured schizont, SURFIN_4.2 antibody showed a distinct staining of the merozoite apex while the pattern observed with SURFIN_4.1 antibody was not apical but rather spread around the merozoite (Figure 3).

Co-localization experiments were carried out between SURFIN_4.1 and the micronemal protein EBA175, and SURFIN_4.2. In the intact schizont, SURFIN_4.1 appears to co-localize in part with EBA175, but the proteins differentiate in the ruptured schizont. SURFIN_4.1 is spread around the pre-released merozoites, while EBA175 localizes at the apical end of the merozoite (Figure 4A). SURFIN_4.1 is also co-localized with SURFIN_4.2 in the intact schizont but again the two proteins differentiate in the ruptured (segmented) schizont as SURFIN_4.1 is spread around the pre-released merozoites while SURFIN_4.2 is also seen on the merozoites but with apical staining (Figure 4A–B).

Agglutination assay on pRBCs and RBC binding assay on uninfected RBCs with rabbit-anti-SURFIN_4.1-C1 whole serum showed no agglutinates in either 3D7S8 or FCR3 (30 h and 40 h cultures).