www.malariajournal.com

Table 1
Oligonucleotide primers
Domain	PCR primer (5'-3')	RE

10 kDa	F: catgggatcctggaagaaaaagagagaaag	BamH I
	R: catgctcgagtcagggtgagtgagtggataag	Xho I
16 kDa	F: catgggatcctttcgatacagtggccggact	BamH I
	R: catgctcgagtcatgcttctgtgggctctggct	Xho I
22 kDa	F: catgggatccttccgaactcttaacatcaatgggcaaa	BamH I
	R: catgctcgagtcactcatcagcaatctcggtctcc	Xho I
30 kDa	F: catggaattcatgcactgcaaggtttctttgt	EcoR I
	R: catgctcgagtcatttggatcctagcgcaag	Xho I
PfJ	F: catgcatgcatatgcctgaagtagttccacaagaa	Nde I
	R: catgggatccttatgcactttcacctccccc	BamH I

Forward (F) and reverse (R) primer sequences were designed for amplifying the different human 4.1R domain sequences and P. falciparum 4.1R binding sequence (PfJ) in EBA-181. Endonuclease recognition sequences are underlined and the corresponding restriction enzyme (RE) indicated.
Lanzillotti and Coetzer Malaria Journal 2006 5:100 doi:10.1186/1475-2875-5-100

Table 1